MEGAResFrom MEG, the Microbial Ecology Group

MARR

The marR gene encodes a MarR family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|pvgb|U00096|1619119-1619554|ARO:3003378|Escherichia|Multi-drug_resistance|MDR_regulator|MARR|RequiresSNPConfirmation
GTGAAAAGTACCAGCGATCTGTTCAATGAAATTATTCCATTGGGTCGCTTAATCCATATGGTTAATCAGAAGAAAGATCG
CCTGCTTAACGAGTATCTGTCTCCGCTGGATATTACCGCGGCACAGTTTAAGGTGCTCTGCTCTATCCGCTGCGCGGCGT
GTATTACTCCGGTTGAACTGAAAAAGGTATTGTCGGTCGACCTGGGAGCACTGACCCGTATGCTGGATCGCCTGGTCTGT
AAAGGCTGGGTGGAAAGGTTGCCGAACCCGAATGACAAGCGCGGCGTACTGGTAAAACTTACCACCGGCGGCGCGGCAAT
ATGTGAACAATGCCATCAATTAGTTGGCCAGGACCTGCACCAAGAATTAACAAAAAACCTGACGGCGGACGAAGTGGCAA
CACTTGAGTATTTGCTTAAGAAAGTCCTGCCGTAAA