MEGAResFrom MEG, the Microbial Ecology Group

MARA

The marA gene encodes an araC family transcriptional regulator in Escherichia coli.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_007779|1621287-1621671|ARO:3000263|marA|Multi-drug_resistance|MDR_regulator|MARA
ATGTCCAGACGCAATACTGACGCTATTACCATTCATAGCATTTTGGACTGGATCGAGGACAACCTGGAATCGCCACTGTC
ACTGGAGAAAGTGTCAGAGCGTTCGGGTTACTCCAAATGGCACCTGCAACGGATGTTTAAAAAAGAAACCGGTCATTCAT
TAGGCCAATACATCCGCAGCCGTAAGATGACGGAAATCGCGCAAAAGCTGAAGGAAAGTAACGAGCCGATACTCTATCTG
GCAGAACGATATGGCTTCGAGTCGCAACAAACTCTGACCCGAACCTTCAAAAATTACTTTGATGTTCCGCCGCATAAATA
CCGGATGACCAATATGCAGGGCGAATCGCGCTTTTTACATCCATTAAATCATTACAACAGCTAGT