MEGAResFrom MEG, the Microbial Ecology Group

GOLS

The golS gene encodes a MerR family regulator of the mdsABC efflux system. This system is known for resistance to gold.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_003197|400859-401324|ARO:3000504|golS|Multi-drug_resistance|MDR_regulator|GOLS
ATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTACTATGAACAGATTGGTCTGATTCC
CGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTATACGCCGCGCGC
GCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTC
AAACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGC
GCTGATTCACTGCTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGACAACCTGACGATAGCGAGC
CGGAGGCGCGTACCGGAGCGGTATTGCGACGTCCTCGTCGCCACGGACTGGCAAAGCGTCTGTAAG