MEGAResFrom MEG, the Microbial Ecology Group

GADX

The gadX gene encodes an araC family transcriptional regulator that affects the expression of the MdtEF multi-drug efflux system in Escherichia coli.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_007779|3974604-3975429|ARO:3000508|gadX|Multi-drug_resistance|MDR_regulator|GADX
ATGCAATCACTACATGGGAATTGTCTAATTGCGTATGCAAGACATAAATATATTCTCACCATGGTTAATGGTGAATATCG
CTATTTTAATGGCGGTGACCTGGTTTTTGCGGATGCAAGCCAAATTCGAGTAGATAAGTGTGTTGAAAATTTTGTATTCG
TGTCAAGGGACACGCTTTCATTATTTCTCCCGATGCTCAAGGAGGAGGCATTAAATCTTCATGCACATAAAAAAGTTTCT
TCATTACTCGTTCATCACTGTAGTAGAGATATTCCTGTTTTTCAGGAAGTTGCGCAACTATCGCAGAATAAGAATCTTCG
CTATGCAGAAATGCTACGTAAAAGAGCATTAATCTTTGCGTTGTTATCTGTTTTTCTTGAGGATGAGCACTTTATACCGC
TGCTTCTGAACGTTTTACAACCGAACATGCGAACACGAGTTTGTACGGTTATCAATAATAATATCGCCCATGAGTGGACA
CTAGCCCGAATCGCCAGCGAGCTGTTGATGAGTCCAAGTCTGTTAAAGAAAAAATTGCGCGAAGAAGAGACATCATATTC
ACAGTTGCTTACTGAGTGTAGAATGCAACGTGCTTTGCAACTTATTGTTATACATGGTTTTTCAATTAAGCGAGTTGCAG
TATCCTGTGGATATCACAGCGTGTCGTATTTCATTTACGTCTTTCGAAATTATTATGGGATGACGCCCACAGAGTATCAG
GAGCGATCGGCGCAGAGATTGTCGAACCGTGACTCGGCGGCAAGTATTGTTGCGCAAGGGAATTTTTACGGCACTGACCG
TTCTGCGGAAGGAATAAGATTATAGA