MEGAResFrom MEG, the Microbial Ecology Group

EMRR

The emrR gene encodes a transcriptional regulator that affects expression of the EmrAB efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|CP000034|2662758-2663289|ARO:3000516|emrR|Multi-drug_resistance|MDR_regulator|EMRR
ATGGATAGTTCGTTTACGCCCATTGAACAAATGCTAAAATTTCGCGCCAGCCGCCACGAAGATTTTCCTTATCAGGAGAT
CCTTCTGACTCGTCTTTGCATGCACATGCAAAGCAAGCTGCTGGAGAACCGCAATAAAATGCTGAAGGCTCAGGGGATTA
ACGAGACGTTGTTTATGGCGTTGATTACGCTGGAGTCTCAGGAAAACCACAGTATTCAGCCTTCTGAATTAAGTTGTGCT
CTTGGATCATCCCGTACCAACGCGACGCGTATTGCCGATGAACTGGAAAAACGCGGTTGGATCGAACGTCGTGAAAGCGA
TAACGATCGCCGCTGCCTGCATCTGCAATTAACGGAAAAAGGTCACGAGTTTTTGCGCGAGGTTTTACCACCGCAGCATA
ACTGCCTGCATCAACTCTGGTCCGCGCTCAGCACAACAGAAAAAGATCAGCTCGAGCAAATCACCCGCAAATTGCTCTCC
CGTCTCGACCAGATGGAACAAGCCGGTGTGGTTCTCGAAGCGATGAGCTAAC