MEGAResFrom MEG, the Microbial Ecology Group

CMER

The cmeR gene encodes a repressor of the cmeABC multi-drug efflux systme in Campylobacter.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|NC_002163|336915-337548|ARO:3000526|cmeR|Multi-drug_resistance|MDR_regulator|CMER
TTAAGCTTTGGAGCTATTGATTCCATTTAGAAAAACATTTACAACAAATTCAACATGTTCTTTTTGTTCTTTTTTATTTT
TCAAAGGAGCGTTAATTAAAACATTAAGATGATGATAAGGTTCTTTTAACATAGTGCAAAAAAGAACAGCAAGTTTTTCT
GCATTTTTTTTCATATAAGAATTATTTTGTTGCTTGAAAAAACCCATAAGTATGTTATAGGAAAAATTTTGTTGATTATT
TTCTATCCAATTGGCAAGATGTCTATCTTTGTCATAAACTTGAGAATAGATAATTTTACCAAAAGCTACAGCTTCTGGTT
GATTGAAAATTTCTATAAAAGCTAAACCAAAAGAAGTTAAAATTTCTTTTAAAGTGCCATTTTCAATTTCTTGTGTTTTG
GAATAAATAAGATGAAAGTGTTTTTTACATATGTCATCTAAAATTTCAAAGAATAGCCCTTCTTTACTTTTAAAACCATC
ATAAATATTAGAATAAGATCCTCCAGATAATTTAATAATATCACTCAAACTTGTTTCTTGGTATCCTTTTGTTAAAAAAA
GCTCTAAGGCCACTGCTTTGATTTTTTCTTGTCTGGCTAAAACTTTTTGTGATGGTGTTCTATTTGAGTTCATT