MEGAResFrom MEG, the Microbial Ecology Group

ASMA

The asmA gene is hypothesized to control expression of the marRAB operon in Salmonella enterica.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>Mdr|CP000647.1|gene2517|Multi-drug_resistance|MDR_regulator|ASMA
ATGATCCTGCTGGCGGTCATTGTCGCCGGGCTTACCTCGTTGGTATTGCTGGTCAATCCCAACGATTTTCGCGCCTATAT
GGTGCATGAGGTGGCAGAGCGCAGCGGTTATCAGCTTGACCTTGATGGCCCGCTGCGCTGGCACGTCTGGCCGCAGCTCA
GCATTCTCAGCGGACGGATGACGCTGACCGCCCGAGGCGCCGAAGAGCCGGTGATCCGCGCCGACAATATGCGCCTCGAC
GTGGCGCTGCTGCCGCTGCTCTCGCATCAGCTGCAGGTTAAGCAGGTGATGCTCAAGGGCGCGGTGATCCAGCTGACCCC
GAAAACCGAGGCGGTTCGCGACAGCTCAGCGCCGGTGGTGCCGCATGACAACACCCTGCCGCTGGCCCCGGAGGATCGCG
GATGGTCCTACGATGTGCGTCAGCTGCAGGTGGCCGACAGCGTGCTCTTCTTCCAGCACGAGAACGGCGAGCAGGTGACC
GTGCGCGATATCCGTCTGCAGATGGAGCAGGATGAGAATCACCGGGCCACCGTGGATTTCTCCGGCCGGGTGAACCGCGA
CCAGCGCGACCTGGCGCTGAACTTCTCCGCCACCGTGCAGGGCGGCGATTATCCGCACTCCTTAAAAGCCGACTTTACCC
AGCTTAGCTGGCAGCTGCGCGGCGCCGAGCTCCCACCGGACGGCATTAATGGTCAGGGGAGTCTGCAGGCCAGCTGGCAG
GAAGATGACAAGACCCTGCGTTTTGACAACCTGAATCTGATGGCTAACCGCAGCACCGTTACCGGCAGCGGCAGCGTGGT
GCTGGGGGATCGCCCGGACTGGTCGCTGGATTTGCACGCCACCACTCTCGATCTCGATAGTCTGCTGGCGCAAAGGTCGC
CGGCGACGGACAGTAGCGCCAGTCAGCAGGGCCAGAGTCAGACGCGACCGCTGCGCCCGGTGATCGCCGACAGCGATGAG
CGCGAAGATTACCAGAGCCTGCGCGGCTTCAACGGCCGAATGGCCCTGAGCGCCGACCAGCTGCAGTGGCGCGGTCTGAA
CTTCACCCAGGTGCAGAGCGAAATCAGCAACCAGCAGGGGCTGCTGACGGTCAGCAAAATGCAGGGCAATCTTGATGGCG
GGCAGCTCTCTCTCCCTGGCACCCTGGATGCCCGCGGCGACACGCCGCTGGCGACGTTCCAGCCGGCGCTGCAGAATGTG
GAGATCGGTTCGCTGATCAAAGCCTTTAACTATTCCTTAAACCTGACCGGCAAGCTGTCGCTGAGCGGCGAATTTTCCGG
AACGCGCATTGACGCCGATGATTTCCGTCGCCACTGGCAGGGACAGGCTCAGCTCCAGATGGCCGATACCCGCACCGAAG
GGCTGAACTTCCAGCAGCTGGTGCAGCAGGCCGTGGAGCGCAGCACCAACGTGCGGGCGCAGGAAAATTACGACAATGCC
ACCCGCCTGGATTCCGTGAGCAGCCGGCTGACGCTGGATAACGGGCTGGTGACGCTGAACCGCCTGCAGGGGCAGTCCGA
CGTGATGGCGATGACCGGCGAAGGACAGCTCGATCTGCAGAAAGAGAACTGCGATATGCGCTTCAACGTGCGCGTGCTCG
GCGGCTGGAAAGGGGAGGGCAAGCTTATCGACCGCCTGAAACAGACCGCTATCCCGCTGCGCATCTACGGCGAGTGGCAG
TCGCTGAGCTACAGTCTGCAGGTCGACCAGATCCTGCGCAAACAGCTGCAGGATGAAGCGAAGCAGCGCCTCAACGACTG
GGTTGAGCGTAATAAAGGCAGCAAAGACGGCAACGATGCCAAAAAGCTGCTCGATAAGCTGTAA

>Mdr|CP000034.1|gene2198|Multi-drug_resistance|MDR_regulator|ASMA
ATGAGACGATTTCTGACGACGCTGATGATACTCCTGGTCGTGCTGGTGGCCGGGTTATCTGCGTTAGTGTTGCTGGTGAA
TCCGAATGATTTCCGCGACTATATGGTCAAGCAAGTTGCTGCACGTAGCGGTTATCAATTGCAGCTCGACGGGCCACTGC
GTTGGCACGTCTGGCCGCAACTTAGTATCCTCTCCGGGCGAATGTCTCTCACCGCCCAGGGCGCGAGCCAGCCACTGGTT
CGCGCCGACAACATGCGCCTGGACGTGGCGCTTTTACCACTACTGAGTCATCAACTGAGCGTTAAGCAGGTGATGCTAAA
AGGGGCAGTGATCCAACTGACGCCGCAGACGGAAGCGGTGCGCAGTGAAGACGCTCCGGTTGCACCGCGCGACAATACCT
TGCCGGATCTGTCAGACGATCGCGGATGGTCGTTTGATATATCCAGTCTTAAGGTGGCGGACAGCGTTCTGGTGTTCCAG
CATGAAGATGACGAGCAGGTGACAATCCGCAATATCCGCCTGCAAATGGAACAAGATCCCCAACATCGTGGCTCATTTGA
GTTCTCCGGGTGGGTTAATCGCGATCAGCGCGATCTCACGATATCCCTTAACGGTACGGTGGATGCTTCTGATTATCCGC
ATGATTTAACGGCTGCTATTGAACAAATTAACTGGCAGTTGCAGGGTGCCGATTTACCAAAACAAGGCATTCAGGGGCAG
GGGAGTTTCCAGGCCCAGTGGCAGGAGTTACATAAACGCCTTTCATTTAACCAAATCAGCTTGACCGCCAATGACAGTAC
GCTGAGTGGGCAAGCACAGGTTACGCTGACAGAGAAACCGGAATGGCAGCTGAGGCTGCAATTCCCGCAACTGAATCTTG
ACAACCTCATCCCGCTTAATGAAACAGCGAATGGTGAAAACGGTGCCGCGCAGCAGGGGCAGAGCCAATCAACGTTGCCG
CGCCCGGTTATTTCTTCGCGTATTGATGAACCGGCCTATCAGGGACTGCAAGGCTTTACGGCTGATATTTTGTTGCAGGC
CAGTAACGTGCGCTGGCGCGGAATGAATTTTACAGATGTTGCCACGCAAATGACCAACAAGTCGGGTTTGCTGGAAATTA
CTCAACTGCAGGGCAAGCTTAACGGTGGACAGGTTTCACTGCCGGGCACGCTGGACGCGACATCAATAAATCCGCGGATA
AACTTCCAGCCACGGCTGGAAAACGTTGAGATTGGCACCATTCTGAAGGCGTTTAACTATCCGATTTCGTTGACCGGAAA
GATGTCACTGGCTGGTGATTTCTCCGGTGCTGACATAGATGCCGACGCATTCCGCCACAACTGGCAAGGACAGGCACATG
TCGAAATGACCGACACGCGCATGGAAGGGATGAACTTCCAGCAGATGATTCAGCAAGCGGTAGAACGTAATGGTGGTGAT
GTGAAGGCCGCTGAAAACTTCGATAACGTAACGCGTCTTGAGCGCTTTACCACCGATTTGACGTTGAAGGCTGGCGTCGT
GACGTTAAACGACATGCAAGGTCAATCGCCTGTGCTGGCGCTTACAGGGGAAGGTATGTTGAATCTGGCAGCTCAAACCT
GCGACACCCAGTTTGATCTTCGGGTCGTGGGTGGCTGGAACGGGGAAAGCAAACTGATTGATTTCCTCAAAGAAACGCCA
GTACCGCTGCGGGTTTATGGCAACTGGCAGCAACTCAATTACAGTCTGCAAGTGGATCAGTTACTGCGCAAACATCTACA
GGACGAAGCGAAACGTCGCCTGAATGACTGGGCCGAGCGGAATAAAGATTCCCGCAATGGCAAAGATGTGAAGAAGTTGC
TGGAGAAGATGTAA