MEGAResFrom MEG, the Microbial Ecology Group

ADEN

The adeN gene encodes a TetR-type transcriptional regulator of the adeIJK efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|phgb|KF147862|0-654|ARO:3000559|adeN|Multi-drug_resistance|MDR_regulator|ADEN
ATGCATGATCCAGTCCTTGAGTCACATCATCTCGTATGTGAAAAACCCCAAACACGCCGCGGTATAGAACGTCGTTTAGC
TCTATTGCTAAGCGCAACCGAGCTGTTTTTGGAAAAAGGATATGATGCTGTCTCTCTTGACGACATCGTTAATCATGCTG
GTGGTTCAAAAACCTCTATTTATAAATACTTCGGTAATAAAGATGGCTTATTTACTGCAATCTGCGATTATCGCCGTGAA
ATGTTTTTTAAAGATATCTGCATTGCATTTCAACCAGAGCAAACTTCTTTAAAAGATTATTTAATCCAAACTCTCATCCG
TTTTTATAAGCCCTTTATTCAACCTGAACACATTGCCTTTTTACGTTTGGTTATTGAACAAACTCAATGTAATGCAACTT
TGAGCCAATACTTATATGAAAAATGTGCTCTGGATGTCCAAAATACAATTGCTCAAGCCTTACTCATATCTCATCAATCA
GGTGAAATTACCTGTACATCTCCTGATCATTCCTCTCTTATGTATTTTGGAATTTTACGTGATATTGAATGGCGAATGAT
TATGGGAATGCCTCTCCCACCCAATGAGACAGAAGTTATTGATTATATTAATTATTGTGTTGATATTTTCTTAAAGGGGC
ATCATAAAGTCTAA