MEGAResFrom MEG, the Microbial Ecology Group

ACRR

The acrR gene encodes a TetR family transcriptional regulator that affects expression of the AcrAB multi-drug efflux system.

References

Other Groups in MDR regulator

Sequences

Download Sequences

>CARD|pvgb|CP000647|489264-489915|ARO:3003373|Klebsiella|Multi-drug_resistance|MDR_regulator|ACRR|RequiresSNPConfirmation
ATGGCACGAAAAACCAAACAACAGGCACGTGAAACCCGGCAACTGATTCTGGATGTTGCTCTGCGTCTGTTTTCGCAGCA
AGGCGTATCATCTACCTCGTTGGCAACAATTGCAAAAGCTGCGGGTGTAACGAGGGGGGCTATCTACTGGCATTTCAAGA
ATAAATCAGATTTATTCAACGAAATTTGGGAGCTGTCAGACGCCAGTATTAGCGATCTCGAAATTGAGTATCGGGCAAAA
TTCCCCAACGATCCACTCTCAGTTATCAGGGAGATTCTAGTCTATGTTCTTGAAGCGACAGTGACAGAAGAACGTCGACG
ATTAATGATGGAGATTATCTATCATAAGTGTGAGTTCGTCGGTGAAATGACCGTGGTGCAGCAGGCCCAGCGGCAGCTCT
CCCTGGCGAGTTATGAGCGTATCGAGCAGACCTTGAAAGAGTGCATCGCGGCGAAGCTGCTGCCCGCCAATTTACTCACC
CGGCGGGCGGCCGTGTTAATGCGCAGCTACCTTTCCGGGCTGATGGAAAACTGGCTGTTTGCCCCCGATTCGTTCGACCT
GCATGCGGAAGCGCGGGACTACGTCGCTATTCTGCTGGAGATGTATCAATTCTGCCCGACGCTACGCGGCCCGGAGAGCT
TGTCAGCTTAAA

>CARD|pvgb|NC_014121|1270697-1271351|ARO:3003374|Enterobacter|Multi-drug_resistance|MDR_regulator|ACRR|RequiresSNPConfirmation
ATGGCACGAAAAACCAAACAACAAGCGCTTGAAACCCGACAACACATTCTGGATGTGGCAATCCGCTTATTTTCTCAGCA
AGGTGTTTCGTCAACCTCGCTGGCACAGATTGCTCAGGCCGCTGGCGTTACGCGGGGAGCGATTTACTGGCATTTTAAAG
ACAAGTCAGATCTGTTCAGTGAAATCTGGGAGCTTTCAGAGTCCAGCATTAGCGATCTCGAGAGTGAGTATCGGGCAAAA
TTCCCTGACGATCCACTCTCAGTATTAAGAGAAATATTAGTATATATCCTTGAAGCGACGGTAGTTGAAGAGCGCCGTCG
GTTAATGATGGAAATTATTTTCCATAAATGTGAGTTTGTGGGAGAGATGGCTGTTGTGCAGCAGGCGCAACGCAGCCTTA
GCCTGGAAAGCTATGACCGCATTGAACAGAACCTGAACCAGTGCATGCAGGCTAAACTGTTACCGGCCAATCTCCTGACC
CGCCGGGCGGCTATTCTGATGCGCAGCTACATTTCGGGCCTGATGGAAAACTGGCTTTTCGCCCCGCAATCCTTTGACTT
AAAAGCGGAAGCCCGCAGCTACGTGGCGATTTTACTGGAAATGCTACAGCTCTGCCCGACGCTGCGCAGCGACGCGCCTT
CGCTCACTGCCTGA