MEGAResFrom MEG, the Microbial Ecology Group

mprF

The mprF gene encodes a bacterial defensin resistance protein. Mutations in this gene have been linked to daptomycin resistance and multi-drug resistance.

References

Other Groups in MDR mutant porin proteins

Sequences

Download Sequences

>CARD|phgb|AL009126|916777-919348|ARO:3000863|mprF|Multi-drug_resistance|MDR_mutant_porin_proteins|mprF|RequiresSNPConfirmation
TTGCTGATTAAAAAGAATGCTTTATCAATATTAAAAATCGTTTTTCCTATTGCTGTTTTGCTATTTGTTATTTATCAATC
GAAAAAAGAACTGACAAATCTGTCATTCAAACGTACGCTCATGGTCATCAACGGACTGGAACGAACGGATTTATTCATGC
TTGTGTTGATCGGCTTGCTGGCTGTTGCGGCTATGTCGCTGTATGATTACGTCCTGAAGTACTCACTGCGCCTATCGATC
ACAAACGGAAAAGTTTTCAGGGTTTCCTGGATCGCCAATTCATTTAATAATGTGTTGGGATTCGGCGGTTTAGCCGGAGT
CGGGTTAAGAATGATGTTCTATAAGGAGCATACGAAAGACCATAAGGCACTCGTGAAAGGAATCGCCTGGCTCACATCAT
CTATGCTGCTCGGATTATCTGTTTTCAGCATTTTCGTTGCTGCGAGAGTGCTGCCAGTTGATGAAGTGATTCATGAGAAG
CCTTGGCTGTGGGCGGTCGTTATCGGTTTTGCACTGATATTGCCGTTATCTTTAGCGGTGTCCAAAATAAAAGACCGCAA
AGCTGGGGACGAAGAGAATGCGGATAAAGTGAAAAATCCGATTTTCGCATATATTGGAGCTTCAGTTGTTGAATGGCTCA
TGGCCGGGACCGTCATCTATTTTGCTTTGTTCGCTATGGGCATTCATGCAGATATCAGGTATGTGTTCGGGGTGTTCGTC
ATTGCGGCGATCGGAGGAATGATCAGCCTCGTGCCGGGCGGCTTCGGCTCGTTTGACCTTTTATTTTTGCTGGGGATGGA
GCAGCTTGGCTATCATCAAGAGGCCATCGTTACTTCTATTGTGTTGTACAGGCTCGCCTACTCATTTATCCCATTTATCT
TGGGACTGTTCTTTGCCGCCGGCGACCTGACGGAAAATACAATGAAGCGGCTCGAAACGAACCCGCGCATCGCACCGGCA
ATTGAGACGACAAACGTTCTGCTTGTTGTTCAGCGTGCGGTATTAGTGAGAATTTTGCAAGGCTCGCTTTCCCTTATTGT
GTTCGTAGCAGGTCTGATTGTCTTGGCCTCAGTTTCCTTGCCGATTGACAGGCTGACGGTTATACCGCACATTCCGCGCC
CGGCGCTTTTGCTGTTCAACGGCCTGTCCTTAAGCTCAGCGCTCATTCTGCTCATTTTGCCGATCGAGCTTTATAAACGG
ACAAAACGTTCCTACACGATGGCCATTACAGCGCTTGTCGGCGGCTTTGTGTTCAGCTTTTTAAAAGGGCTTAACATCAG
CGCGATATTCGTACTGCCGATGATTATCGTATTGCTTGTGCTATTGAAAAAACAATTTGTCCGCGAACAGGCATCCTATA
CACTGGGACAATTGATATTCGCTGTGGCGCTGTTTACTGTGGCGCTCTTTAACTACAATCTGATCGCGGGCTTTATTTGG
GACCGGATGAAGAAGGTGCTGCGTCACGAATATTTCGTCCACAGCACCTCGCATATTACACATGCAACCATCATGGCGAT
CATCATTGTGCCGCTGTTCTTCTTGATATTTACAGTGGTCTATCATAAGAGAACGAAACCGATCGGAGAGAAAGCTGACC
CTGAGCGTCTTGCTGCGTTTCTCAATGAAAAAGGCGGCAACGCGCTGAGCCATCTTGGTTTTCTTGGAGATAAGCGGTTT
TATTTTTCTAGCGATGGAAATGCACTGCTTCTGTTTGGGAAAATCGCCAGAAGGCTGGTCGTGCTCGGCGATCCATCTGG
CCAAAGAGAATCATTCCCGCTCGTGCTGGAAGAATTTCTGAACGAAGCGCATCAGAAGGGATTCAGTGTTTTGTTCTATC
AAATTGAACGAGAGGACATGGCGCTGTATCACGATTTTGGCTACAACTTCTTTAAATTGGGTGAGGAAGCATATGTAGAT
TTAAATACATTTACCTTGACTGGGAAGAAAAAAGCCGGCCTTCGGGCAATCAATAACCGCTTTGAGCGGGAGGAGTATAC
TTTCCATGTGGATCATCCCCCATTTTCTGATGCGTTTTTGGAGGAGCTGAAGCAAATCTCAGACGAATGGCTCGGCTCGA
AAAAAGAGAAGGGATTCTCGCTCGGATTTTTTGATCCTTCCTATTTACAGAAAGCGCCGATCGCCTATATGAAAAATGCA
GAAGGAGAGATCGTTGCATTCGCAAATGTCATGCCGATGTACCAGGAAGGAGAGATATCGGTCGATCTGATGCGCTATCG
CGGCGACGCTCCAAATGGCATTATGGACGCATTGTTTATCCGTATGTTTTTATGGGCAAAGGAAGAGGGCTGTACGTCAT
TTAATATGGGGATGGCACCCTTGGCCAATGTCGGCACTGCCTTTACATCCTTCTGGTCCGAAAGGTTTGCCGCTGTCATT
TTTAATAATGTCAGATACATGTACAGTTTCAGCGGCCTAAGAGCCTTTAAAGAAAAATATAAACCGGAGTGGCGAGGGAA
ATACTTAGCGTATCGGAAAAACAGATCTCTTTCTGTCACCATGTTCCTCGTTACACGTCTGATTGGCAAAAGCAAAAAAG
ACTCCGTCTAAT