MEGAResFrom MEG, the Microbial Ecology Group

CLBB

The clb genes encode a cfr-like protein that confers resistance to phenicols via the methylation of the 23S ribosomal RNA.

References

  • http://aac.asm.org/content/early/2012/04/25/AAC.00673-12.full.pdf

Other Groups in MDR 23S ribosomal RNA methyltransferase

Sequences

Download Sequences

>>MEG_1727|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CLBB
ATGAAACTAACCTCGAAATATGAAACGATTCGGCGAATCTTGTCCGAATGCAAGCAGCCTGAGTATCGGTATGCTCAGAT
TATGGACGCCATTTTCAAGCAAAACATCGGCGAATACGAACGGATGACCATCCTACCCAAATTTTTGCGCGACGAGTTGA
ATCGGATACTTGGACCGAACGTTTGCAGTATCGCTCCGGTAAAGGAGCTCACGTCGAAACAGGTTAGCAAGGTGCTGTTT
GCGATTCCGGGCGACGAACAGGTCGAGGCCGTACGACTTACTTATGAACGGGGGTGGAAATCGTATTGTATTTCCACACA
GTGCGGCTGCGGATTCAGGTGCAAGTTTTGTGCTACCGGTACCATTGGTCTGAAACGAAATCTGACCGCCGACGAAATTA
CCGACCAATTGCTGTACTTTCGTTTGAACGGCCACTCTTTGGACAGCATCTCATTCATGGGCATGGGAGAGGCGCTCGCC
AACCCGCATATTTTTGAGGCCATGACGATATTGACCGACCCGTATCTCTTCGGTTTAGGACATCGACGAATTACGATTTC
CACGATCGGCCTGTTGCCGGGGATTGACAAGCTGACTCGGGAGTTCCCCCAGGTCAATCTAACCTTCTCGCTGCATTCAC
CGTTCGACGATCAGCGAAGCGAGCTGATGCCGATCAACGACCGATTTCCAGTCCGTGACGTACTGATAGCATTGGATCGT
CACATCAGGGAAACAGGGAGAAAGGTATATATTGCGTATATTCTTCTTCGTGGAGTAAACGACTCGACAGCGCATGCGGA
AGCAGTTGCCGAGTTGCTAAGGGGAAGGGGAGCTTGGGAACATCTCTACCACGTTAACCTGATTCCATTCAATTCGACCG
AAGTTACGCCAGACAGCTATCGGCAATCCGATCCTTCGCGGATTAAAGCGTTTGTTCGGATCTTGAAGTCAAGGGGGATA
AGCGTCACGGTCCGAACTCAATTCGGATCGGACATAAACGCGGCATGCGGCCAGTTATACCGCTCTGAATAA