MEGAResFrom MEG, the Microbial Ecology Group

CIPA

The CIPA group of genes confer resistance to Multi-drug resistance through the mechanism, MDR 23S ribosomal RNA methyltransferase.

References

    Other Groups in MDR 23S ribosomal RNA methyltransferase

    Sequences

    Download Sequences

    >>MEG_1723|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CIPA
    ATGAAGTATTTATCTAAGTATGAAAAAATACGTAAGATCTTATCGGCTCTAAATCAACCGAATTATAGATATTCGCAAAT
    AACAGAGGCAATCTTCAAGAACAAGATCGGAAATTTCGAAGCAATGAACAACTTGCCTAAGCCTGTAAGAAATGAATTAA
    TCAAAGAGCTTGGAAACAATGTGTTAAGCATCACACCGAAAATGGAGCAGAAATCCAACCAAGTTAGCAAAATTCTGTTT
    GCTATCCCAGGCGATGAATACATTGAATCCGTAAGGTTAAGTTATCAAACGGGCTGGGAATCCTATTGTATCTCTTCGCA
    GTGCGGTTGCGGATTTGGTTGTACATTTTGCGCTACGGGAACACTCGGTTTGAAGAGGAATCTTACAACGGATGAAATAA
    CGGATCAACTGCTTTATTTTACTTTGAATAACCATCCCTTGGACAGTGTGTCTTTTATGGGAATGGGAGAGGCACTTGCA
    AATCCATATGTATTTGATGCTTTGCATTTGCTGACGGATCCTAAACTTTTCGGTTTAGGACATCGAAGGATTACGGTTTC
    TACCATAGGTTTATTACCTGGAGTAAAAAAGTTGACGAAGGAATTTCCACAGATTAATTTAACGTTCTCGCTTCATTCAC
    CATTTCATGATCAGAGAAGCGAGTTAATGCCCATTAACAATCATTTTCCATTAGAAGAAGTTATGACCGTGTTGGACGAG
    CATATTCAGCAAACAAAGCGAAAGGTTTACATTGCTTATATCCTGCTAAGGGGTATCAACGATTCAACTAAACATGCTAA
    AGCCGTTGCTGATTTGTTGCGTGAAAGAGGGTCGTGGGAACATTTATATCACGTCAATCTAATTCCATACAATTCCACTG
    ATGCCACATCACAAAGTTTTGTAGAGTCGGATCAGAACAGCATCAATATGTTCCTTAGAATCTTGAAGTCAAAGGGAATC
    CATGTCACCGTGAGGACCCAATTCGGATCAGACATCAACGCAGCATGCGGTCAACTATATGGATCAAACGGTAACATTTA
    A