MEGAResFrom MEG, the Microbial Ecology Group

CFRB

The CFRB group of genes confer resistance to Multi-drug resistance through the mechanism, MDR 23S ribosomal RNA methyltransferase.

Other Groups in MDR 23S ribosomal RNA methyltransferase

Sequences

Download Sequences

>MEG_1682|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CFRB
atgcaacaaaaaaataagtatataagaattcaagagttcttgaagcagaataaatttcctaattatagaatgaaacaaat
tacaaatgctatattcccagggagaataaataatttcaacgaaataacggttcttcctaaatcactaagagatatgttaa
ttgaggagtttggagaatcgattttaaatattgttcctttaaaagcacaacaatctacacaagtttcaaaagtcttattt
ggaatttcaggagacgaaaaaatagaaacggtaaatatgaaatataaagctggttgggagtcattttgtatatcatcgca
gtgcggttgtaattttggttgtaaattttgtgcaactggagatataggtttaaaacgtaacttaacttcagatgaaatta
ctgaccagattttgtactttcacttacaagggcattcaattgacagtatttcttttatgggaatgggagaagcattagcg
aatgtacaagtttttgatgctttaaatgtacttacagatcctgcgttgtttgctttaagtccgcgtaggttatctatatc
cactataggaattattccaaacattaaaaaattgactcaaaactatccgcaggtcaacctgacattttcattacattctc
cttttaatgaacagcgaagtgagttaatgccaattaatgaacgctacccattatcagatgtgatggatacattagatgag
catatacgagtaacctcaagaaaagtttatattgcttatattatgttgcacggagttaatgattctattgaacatgcgaa
agaagtcgtaaaccttttaagaggtagatataggagtgggaacttgtatcatgtgaacatcattagatataacccgactg
ttagttcacggatgcggtttgaagaagcaaatgagaaatgtcttgtcaacttttataaaaaattaaagtcagcaggaatt
aaagttaccattagaagtcaatttggcattgatatagacgctgcttgcggtcaattgtatggaaactatcaaaaaaccaa
tagccagtaa

>MEG_1683|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CFRB
ATGCAACAAAAAAATAAGTATATAAGAATTCAAGAGTTCTTGAAGCAGAATAAATTTCCTAATTATAGAATGAAACAAAT
TACAAATGCTATATTCCCAGGGAGAATAAATAATTTCAACGAAATAACGGTTCTTCCTAAATCACTAAGAGATATGTTAA
TTGAGGAGTTTGGAGAATCGATTTTAAATATTGTTCCTTTAAAAGCACAACAATCTACACAAGTTTCAAAAGTCTTATTT
GGAATTTCAGGAGACGAAAAAATAGAAACGGTAAATATGAAATATAAAGCTGGTTGGGAGTCATTTTGTATATCATCGCA
GTGCGGTTGTAATTTTGGTTGTAAATTTTGTGCAACTGGAGATATAGGTTTAAAACGTAACTTAACTTCAGATGAAATTA
CTGACCAGATTTTGTACTTTCACTTACAAGGGCATTCAATTGACAGTATTTCTTTTATGGGAATGGGAGAAGCATTAGCG
AATGTACAAGTTTTTGATGCTTTAAATGTACTTACAGATCCTGCGTTGTTTGCTTTAAGTCCGCGTAGGTTATCTATATC
CACTATAGGAATTATTCCAAACATTAAAAAATTGACTCAAAACTATCCGCAGGTCAACCTGACATTTTCATTACATTCTC
CTTTTAATGAACAGCGAAGTGAGTTAATGCCAATTAATGAACGCTACCCATTATCAGATGTGATGGATACATTAGATGAG
CATATACGAGTAACCTCAAGAAAAGTTTATATTGCTTATATTATGTTGCACGGAGTTAATGATTCTATTGAACATGCGAA
AGAAGTCGTAAACCTTTTAAGAGGTAGATATAGGAGTGGGAACTTGTATCATGTGAACATCATTAGATATAACCCGACTG
TTAGTTCACGGATGCGGTTTGAAGAAGCAAATGAGAAATGTCTTGTCAACTTTTATAAAGAATTAAAGTCAGCAGGAATT
AAAGTTACCATTAGAAGTCAATTTGGCATTGATATAGACGCTGCTTGCGGTCAATTGTATGGAAACTATCAAAAAACCAA
TAGCCAGTAA