MEGAResFrom MEG, the Microbial Ecology Group

CFRA

The cfrA gene encodes a methyltransferase that causes multi-drug resistance, including resistance to the phenicols.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4574374/

Other Groups in MDR 23S ribosomal RNA methyltransferase

Sequences

Download Sequences

>>MEG_1681|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CFRA
atgaattttaataataaaacaaagtatggtaaaatacaggaatttttaagaagtaataatgagcctgattatagaataaa
acaaataaccaatgcgatttttaaacaaagaattagtcgatttgaggatatgaaggttcttccaaaattacttagggagg
atttaataaataattttggagaaacagttttgaatatcaagctcttagcagagcaaaattcagagcaagttacgaaagtg
ctttttgaagtatcaaagaatgagagagtagaaacggtaaacatgaagtataaagcaggttgggagtcattttgtatatc
atcacaatgcggatgtaattttgggtgtaaattttgtgctacaggcgacattggattgaaaaaaaacctaactgtagatg
agataacagatcaagttttatacttccatttattaggtcatcaaattgatagcatttcttttatgggaatgggtgaagct
ctagccaaccgtcaagtatttgatgctcttgattcgtttacggatcctaatttatttgcattaagtcctcgtagactttc
tatatcaacgattggtattatacctagtatcaaaaaaataacccaggaatatcctcaagtaaatcttacattttcattac
actcaccttatagtgaggaacgcagcaaattgatgccaataaatgatagatacccaatagatgaggtaatgaatatactc
gatgaacatataagattaacttcaaggaaagtatatatagattatatcatgttgcctggtgtaaatgattctcttgagca
tgcaaacgaagttgttagccttcttaaaagtcgctataaatcagggaagttatatcatgtaaatttgatacgatacaatc
ctacaataagtgcacctgagatgtatggagaagcaaacgaagggcaggtagaagccttttacaaagttttgaagtctgct
ggtatccatgtcacaattagaagtcaatttgggattgatattgacgctgcttgtggtcaattatatggtaattatcaaaa
tagccaatag

>>MEG_1682|Drugs|Multi-drug_resistance|MDR_23S_ribosomal_RNA_methyltransferase|CFRA
ATGAATTTTAATAATAAAACAAAGTATGGTAAAATACAGGAATTTTTAAGAAGTAATAATGAGCCTGATTATAGAATAAA
ACAAATAACCAATGCGATTTTTAAACAAAGAATTAGTCGATTTGAGGATATGAAGGTTCTTCCAAAATTACTTAGGGAGG
ATTTAATAAATAATTTTGGAGAAACAGTTTTGAATATCAAGCTCTTAGCAGAGCAAAATTCAGAGCAAGTTACGAAAGTG
CTTTTTGAAGTATCAAAGAATGAGAGAGTAGAAACGGTAAACATGAAGTATAAAGCAGGTTGGGAGTCATTTTGTATATC
ATCACAATGCGGATGTAATTTTGGGTGTAAATTTTGTGCTACAGGCGACATTGGATTGAAAAAAAACCTAACTGTAGATG
AGATAACAGATCAAGTTTTATACTTCCATTTATTAGGTCATCAAATTGATAGCATTTCTTTTATGGGAATGGGTGAAGCT
CTAGCCAACCGTCAAGTATTTGATGCTCTTGATTCGTTTACGGATCCTAATTTATTTGCATTAAGTCCTCGTAGACTTTC
TATATCAACGATTGGTATTATACCTAGTATCAAAAAAATAACCCAGGAATATCCTCAAGTAAATCTTACATTTTCATTAC
ACTCACCTTATAGTGAGGAACGCAGCAAATTGATGCCAATAAATGATAGATACCCAATAGATGAGGTAATGAATATACTC
GATGAACATATAAGATTAACTTCAAGGAAAGTATATATAGCTTATATCATGTTGCCTGGTGTAAATGATTCTCTTGAGCA
TGCAAACGAAGTTGTTAGCCTTCTTAAAAGTCGCTATAAATCAGGGAAGTTATATCATGTAAATTTGATACGATACAATC
CTACAATAAGTGCACCTGAGATGTATGGAGAAGCAAACGAAGGGCAGGTAGAAGCCTTTTACAAAGTTTTGAAGTCTGCT
GGTATCCATGTCACAATTAGAAGTCAATTTGGGATTGATATTGACGCTGCTTGTGGTCAATTATATGGTAATTATCAAAA
TAGCCAATAG