Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

HSMR

The HSMR group of genes confer resistance to Biocide resistance through the mechanism, Biocide resistance protein.

References


    Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

    Other Groups in Multi-biocide resistance protein

    Sequences

    Download Sequences

    >>MEG_3279|Biocides|Multi-biocide_resistance|Multi-biocide_resistance_protein|HSMR
    GTGCATCCATACGCGTATCTGGCGGCGGCGATCGCCGCGGAGGTGGCCGGCACGACCGCGCTGAAACTGTCCGAGGGGTT
    CTCGAACCCCGCGCCGAGCGTCGTCGTGCTCGTGGGCTACGTGAGTTCGTTTTACTTCCTCGGCCTCGTCCTGGAGGAAC
    TCCCGGTCGGGGTGGTGTACGGGACGTGGGCGGCCGTCGGCATCGTCGCGACGGCGCTCGTCGGCGTGGTCGTGTTCGAG
    GAGTCGGTCGACGTGGCCGGTGTCGTCGGGCTTGCGCTCATTGTCGCGGGCGTCGTCGTGTTGAACGTCGCCTCGGACGC
    CTACACGCCGGCGCACTGA