Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

MEXV

The mexVW genes encode a multi-drug efflux system in Pseudomonas aeruginosa.

References

  • http://mic.microbiologyresearch.org/content/journal/micro/10.1099/mic.0.031260-0#tab2

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Other Groups in Multi-biocide RND efflux pump

Sequences

Download Sequences

>>MEG_3935|Biocides|Multi-biocide_resistance|Multi-biocide_RND_efflux_pump|MEXV
ATGTTGCTCCGCCGCATGTTGATCATGCTCGCCGCGGTGATCGCCGTGGTGGCGATTCTCGCCGGCTACAAGGTCTACTC
CATCCGTCAGCAGATCGCCCTTTTCAGCGCACCGAAACCGCCGATCAGCGTGACCGCCAGCCTGGCCGAAAAGCGTCCCT
GGCAGAGCCGCCTGCCAGCCATCGGCAGCCTCAAGGCATTCCAGGGCGTGACCCTCACCGCCGAAGTCTCCGGCACGGTA
CGCGACGTACTGTTCCTTTCCGGCGACCAGGTGAAGCTGGACCAACCGCTGATCCAGTTGGAAAGCGACGTCGAGGAAGC
CACCCTGCGCACTGCCGAGGCCGATCTCGGCCTGGCCAGGGCCGAGTACCAGCGCGGCCGCGAACTGATCGGCAGCAAGG
CCATCTCGAAAAGCGAATTCGATCGTCTCGCCGCGCAGTGGGCCAAGACCAGCGCCACCGTCGCCGAGCTGAAGGCGGCG
CTGGCGAAGAAGCGCGTGCTCGCGCCCTTCGCCGGGACCATCGGCATCCGCCAGGTGGACGTCGGCGACTACGTCTCGCC
CGGGACGCCGATCGCCACCTTGCAGGACCTTTCCACCCTGCTCCTGGATTTCCACCTGCCCGAGCAGGACTTCCCCCTGC
TCAGCCGCGGCCAACTGGTGAAGGTCCGGGTCGCCGCCTACCCCGCCCAGGTGTTCGACGCCGAGATCGCCGCCATCAAC
CCCAAGGTCGACAACGAGACCCGCAACCTGCAGGTCCGCGCTGCCCTGGAGAACCCGGACGGCAAGCTGCTGCCGGGCAT
GTTCGCCAACCTCGAGGTGATGTTGCCTGGCGAGGAACAACGCGTCGTGGTCCCGGAGACGGCGATCACCTTCACCCTCT
ACGGCGACTCGATCTACGTCGTCGGGCAGAAGAAGGACGAGCAGGGCCAGGTGTCGAAGGATGACAAGGGCCAGCCGCAA
CAGGTCGTCGAGCGCCGCTTCGTCAGGATCGGCGAACGCCGCGAAGGCCTGGCGGTGGTGCTCGAAGGCCTTGAGGGCGG
CGAGCAGGTAGTGACTTCCGGGCAACTGAAGCTCGACAACGGCGCCGCGGTGGCCATCGTCGCCGAGCGGGACCTCCAGC
AAGAGCACTGA