MEGAResFrom MEG, the Microbial Ecology Group

VGAD

The vgaD gene encodes an efflux pump that has demonstrated activity against streptogramin A antibiotics.

References

Other Groups in Streptogramin A efflux pumps

Sequences

Download Sequences

>CARD|phgb|GQ205627|1393-2971|ARO:3002832|vgaD|MLS|Streptogramin_A_efflux_pumps|VGAD
ATGCTCATTCTTGAAGCGAATCATATTGAAAAATCTATAAATGACCGGAAACTTTTAGATGTTACTCATCTACAAATTCA
TTATGAGGATCGGATTGGTGTAGTTGGTCGTAATGGAAGCGGGAAAACGACATTATTATCTATATTGGCTGGTGAAATAG
AAGCAGATAAAGGTGAAGTGAAAACAAGTGCAAGTCGCTACTTTTTACCTCAATTGAAGGAGACGGATACTTTCAGAAGT
GGTGGTGAGATAACAAAAAGCTATATTGACAAAGCATTAGCGATGAAGGCGGAAATATTGTTTGCCGACGAACCAACTAC
AAACCTTGATACCCACAATATAAAAGAACTTGAAAAGCATTTCAGTCGATATCGGGGGGCAATCATTCTTGTATCACATA
ACCGGTATTTTTTAGATCAAATTTGTACAAAAATATGGGAAATTGAAGATGGAGAAGTGAAAGAAATTCACGGTAACTAT
ACAAGTTATGTAAAACAAAAAGAACTACTTCGTCGACAGCAACAAGAGGAATATGAAAAATATATAACGAAGAAAAAGCA
ACTGGAGCGAGCTGTTACCATGAAAGAACAAAAGGCGCAAAAAATGATTAAGCCTCCTTCTAAACAAATGGGTACTTCTG
AATCTCGAATATGGAAGATGCAGCATGCGACTAAACAAAAGAAAATGCATCAAAATATTAAGGCTCTTGAAACACGTGTT
GAAAAACTAGAGCGTGTGAAAAAACCAAAAGATTATCCGGCTGTCAAAATGAAGTTGTCTAACCAAGATCAAATACAGGG
GCGCAATGTACTTCGGGTAAAAGACTTATCTGTTTCCTTTGGGAATCATGTGCTTTGGACAGATGCTTCTTTTACCATTA
AAGGCGGGGAGAAGGCTGCCATTATTGGCAATAATGGGGTCGGTAAAACAACATTGTTGAAACAAATTTTAGAAAGGGTA
CCAGCGGTAACAATATCACCCGCAGCAAAAATCGGCTATTTTAGCCAGAATTTGGATACGCTTGATACGCATGTGTCGAT
CTTAGAAAATGTCATGTCCACCGCTATTCAAGATGAAACTACTGTACGGACTGTTCTCGCAAGATTACATTTCTACCGGG
AGGATGTTTATAAGGAAGTTCAAGTCCTAAGTGGTGGGGAACGTGTGAAGGTTGCTTTTGCAAAACTATTTGTTAGCGAC
TATAATACGTTGATTCTGGATGAACCAACAAATTATTTAGACATTGATGCCATAGAAGCGTTAGAGGAGCTCCTAATTAA
CTATGAGGGGGCAGTACTATTTGTATCTCATGATTGTCGTTTCGTTCAAAATATTGCATCCAAAATTATTGAACTATCCG
ACCAGAAGGTTATAGAGTTTCTTGGAAGCTATAAAGCGTTTAGAGAAAGATCTCAAGAGACAGAGCGTGACTATATGAAG
GAAGAACTTCTTAAAATTGAGATCAAACTCACTCAAATGATTAGTGAAATGAATGACGAGGCATCAAATGAATTAGAAAA
AGAATTCCAAATGTTGATTCATGAACGTAATCAGTTAAGAAATCAAGTAAACAATTAGA