MEGAResFrom MEG, the Microbial Ecology Group

VGAB

The vgaB gene encodes an efflux pump that has demonstrated activity against streptogramin A antibiotics.

References

Other Groups in Streptogramin A efflux pumps

Sequences

Download Sequences

>CARD|phgb|U82085|0-1659|ARO:3000118|vgaB|MLS|Streptogramin_A_efflux_pumps|VGAB
ATGCTTAAAATCGACATGAAGAATGTAAAAAAATATTATGCAGATAAATTAATTTTAAATATAAAAGAACTAAAGATTTA
TAGTGGGGATAAAATAGGTATTGTAGGTAAGAATGGAGTTGGCAAAACAACACTTTTAAAAATAATAAAAGGACTAATAG
AGATTGACGAAGGAAATATAATTATAAGTGAAAAAACAACTATTAAATATATCTCTCAATTAGAAGAACCACATAGTAAG
ATAATTGATGGAAAATATGCTTCAATATTTCAAGTTGAAAATAAGTGGAATGACAATATGAGTGGTGGTGAAAAAACTAG
ATTTAAACTAGCAGAGGGATTTCAAGATCAATGTTCTTTAATGCTCGTAGATGAACCTACAAGTAATTTAGATATCGAAG
GAATAGAGTTGATAACAAATACTTTTAAAGAGTACCGTGATACTTTTTTGGTAGTATCTCATGATAGAATTTTTTTAGAT
CAAGTTTGTACAAAAATTTTTGAAATTGAAAATGGATATATTAGAGAATTCATCGGTAATTATACAAACTATATAGAGCA
AAAAGAAATGCTTCTACGAAAGCAACAAGAAGAATACGAAAAGTATAATTCTAAAAGAAAGCAATTGGAGCAAGCTATAA
AGCTAAAAGAGAATAAGGCGCAAGGAATGATTAAGCCCCCTTCAAAAACAATGGGAACATCTGAATCTAGAATATGGAAA
ATGCAACATGCTACTAAACAAAAAAAGATGCATAGAAATACGAAATCGTTGGAAACACGAATAGATAAATTAAATCATGT
AGAAAAAATAAAAGAGCTTCCTTCTATTAAAATGGATTTACCTAATAGAGAGCAATTTCATGGTCGCAATGTAATTAGTT
TAAAAAACTTATCTATAAAATTTAATAATCAATTTCTTTGGAGAGATGCTTCATTTGTCATTAAAGGTGGAGAAAAGGTT
GCTATAATTGGTAACAATGGTGTAGGAAAAACAACATTGTTGAAGCTGATTCTAGAAAAAGTAGAATCAGTAATAATATC
ACCATCAGTTAAAATTGGATACGTCAGTCAAAACTTAGATGTTCTACAATCTCATAAATCTATCTTAGAAAATGTTATGT
CTACCTCCATTCAAGATGAAACAATAGCAAGAATTGTTCTAGCAAGATTACATTTTTATCGCAATGATGTTCATAAAGAA
ATAAATGTTTTGAGTGGTGGAGAACAAATAAAGGTTGCTTTTGCCAAGCTATTTGTTAGCGATTGTAATACATTAATTCT
TGATGAACCAACAAACTATTTGGATATCGATGCTGTTGAGGCATTAGAAGAATTGTTAATTACCTATGAAGGTGTTGTGT
TATTTGCTTCCCATGATAAAAAATTTATACAAAACCTAGCTGAACAATTGTTAATAATAGAAAATAATAAAGTGAAAAAA
TTCGAAGGAACATATATAGAATATTTAAAAATTAAAGATAAACCAAAATTAAATACAAATGAAAAAGAACTCAAAGAAAA
AAAGATGATACTAGAAATGCAAATTTCATCATTATTAAGTAAAATCTCAATGGAAGAAAATGAAGAAAAAAACAAAGAAT
TAGATGAAAAGTACAAATTGAAATTAAAAGAATTGAAAAGCCTAAATAAAAATATTTAAA