Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VATE

The vat genes encode streptogramin A O-acetyltransferases that deactivate streptogramin antibiotics by transfer of the acetyl group from acetyl-CoA to the antibiotic molecule.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4249515/

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Streptogramin A O-acetyltransferase

Sequences

Download Sequences

>>MEG_7626|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
atgactatacctgacgcaaatgcaatttatcccaatccagccatcaaagaggttgtctttatcaagaacgtgatcaaaag
tcccaatattgaaattggggactacacctattatgatgacccagtaaatcccaccgattttgagaaacacgttacccatc
actatgaatttctaggcgacaaattaatcatcggtaaattctgttctatcgccagtggtattgaatttattatgaacggt
gccaatcacgtaatgaaaggtatttcaacttatccatttaatattttgggtggcgattggcagaaatatactcctgaact
gactgatttgccgttgaaaggtgatactgtagtcggaaatgacgtgtggtttgggcaaaatgtgaccgtcctaccaggcg
taaaaataggtgacggtgccattatcggagcaaatagtgtcgtaacaaaagacgtcgctccatatacaattgtcggtggc
aatccaattcaactcatcggaccaagatttgaaccagaagttattcaagcattagaaaacctggcatggtggaataaaga
tgttgaatggataactgttaatgttcctaaactaatgcaaacaacgcccacagttgaattgataaacagtttaatggaaa
aataa

>>MEG_7627|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAATCTATCCTAACCTAGCCATCAAAGAGGTTGTCTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTATCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATTTTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGATTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA

>>MEG_7628|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAATCTATCCTAACCTAGCCATCAAAGAGGTTGTCTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTATCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATTTTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGTTTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA

>>MEG_7629|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAATCTATCCTAACTCAGCCATGATAGAGGTTGTCTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTATCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATTTTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGATTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA

>>MEG_7630|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAATCTATCCTAACTCAGCCATCATAGAGGTTGTCTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTATCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATTTTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGATTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA

>>MEG_7631|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAGTCTATCCTAACCTCATCCTCATAGAGCTAGACTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTATCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATTTTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGATTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA

>>MEG_7632|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATE
ATGACTATACCTGACGCAAATGCAATCTATCATAACTCAGCCATCAAAGAGGTTGTCTTTATCAAGAACGTGATCAAAAG
TCCCAATATTGAAATTGGGGACTACACCTATTATGATGACCCAGTAAATCCCACCGATTTTGAGAAACACGTTACCCATC
ACTATGAATTTCTAGGCGACAAATTAATCATCGGTAAATTTTGTTCTCTCGCCAGTGGCATTGAATTTATCATGAACGGT
GCCAACCACGTAATGAAAGGTATTTCGACTTATCCATTTAATATATTAGGTGGCGATTGGCAACAATACACTCCTGAACT
GACTGATTTGCCGTTGAAAGGTGATACTGTAGTCGGAAATGACGTGTGGTTTGGGCAAAATGTGACCGTCCTACCAGGCG
TAAAAATAGGTGACGGTGCCATTATCGGAGCAAATAGTGTTGTAACAAAAGACGTCGCTCCATATACAATTGTCGGTGGC
AATCCAATTCAACTCATCGGACCAAGATTTGAACCGGAAGTTATTCAAGCATTAGAAAATCTGGCATGGTGGAATAAAGA
TATTGAATGGATAACTGCTAATGTTCCTAAACTAATGCAAACAACACCCACACTTGAATTGATAAACAGTTTAATGGAAA
AATAA