MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VATC

The vatC gene encodes a streptogramin A O-acetyltransferase that modifies the secondary alcohol of streptogramin A.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/20713681

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Streptogramin A O-acetyltransferase

Sequences

Download Sequences

>>MEG_7623|Drugs|MLS|Streptogramin_A_O-acetyltransferase|VATC
ATGAAATGGCAAAATCAGCAAGGCCCCAATCCAGAAGAAATATACCCTATAGAAGGTAATAAACATGTTCAATTTATTAA
ACCATCTATAACAAAGCCCAATATTTTAGTTGGGGAATATTCATATTACGATAGTAAAGATGGTGAATCTTTTGAAAGCC
AAGTTCTTTATCACTATGAATTGATTGGGGATAAACTAATATTAGGGAAGTTTTGTTCTATTGGACCCGGAACGACATTT
ATAATGAATGGGGCTAATCATCGTATGGATGGTTCAACATTTCCATTCAATCTTTTCGGAAATGGTTGGGAGAAGCATAC
CCCTACATTGGAAGACCTTCCTTATAAGGGTAACACGGAAATTGGGAACGATGTTTGGATTGGACGAGATGTGACAATTA
TGCCCGGTGTAAAAATAGGAAACGGGGCTATTATTGCAGCAAAATCGGTTGTGACAAAGAACGTTGATCCTTATTCAGTT
GTTGGCGGTAATCCTTCACGATTAATTAAGATAAGGTTTTCCAAGGAAAAAATCGCAGCATTACTAAAAGTAAGGTGGTG
GGACCTAGAGATAGAGACGATAAATGAAAATATTGATTGCATCCTGAATGGTGATATAAAAAAGGTTAAAAGAAGTTAG