MEGAResFrom MEG, the Microbial Ecology Group

VATC

The vatC gene encodes a streptogramin A O-acetyltransferase that modifies the secondary alcohol of streptogramin A.

References

Other Groups in Streptogramin A O-acetyltransferase

Sequences

Download Sequences

>CARD|phgb|AF015628|1306-1945|ARO:3002842|vatC|MLS|Streptogramin_A_O-acetyltransferase|VATC
ATGAAATGGCAAAATCAGCAAGGCCCCAATCCAGAAGAAATATACCCTATAGAAGGTAATAAACATGTTCAATTTATTAA
ACCATCTATAACAAAGCCCAATATTTTAGTTGGGGAATATTCATATTACGATAGTAAAGATGGTGAATCTTTTGAAAGCC
AAGTTCTTTATCACTATGAATTGATTGGGGATAAACTAATATTAGGGAAGTTTTGTTCTATTGGACCCGGAACGACATTT
ATAATGAATGGGGCTAATCATCGTATGGATGGTTCAACATTTCCATTCAATCTTTTCGGAAATGGTTGGGAGAAGCATAC
CCCTACATTGGAAGACCTTCCTTATAAGGGTAACACGGAAATTGGGAACGATGTTTGGATTGGACGAGATGTGACAATTA
TGCCCGGTGTAAAAATAGGAAACGGGGCTATTATTGCAGCAAAATCGGTTGTGACAAAGAACGTTGATCCTTATTCAGTT
GTTGGCGGTAATCCTTCACGATTAATTAAGATAAGGTTTTCCAAGGAAAAAATCGCAGCATTACTAAAAGTAAGGTGGTG
GGACCTAGAGATAGAGACGATAAATGAAAATATTGATTGCATCCTGAATGGTGATATAAAAAAGGTTAAAAGAAGTTAGA