MEGAResFrom MEG, the Microbial Ecology Group

MSRC

The msrC gene encodes an efflux pump that has been shown to function on macrolides.

References

Other Groups in Macrolide resistance efflux pumps

Sequences

Download Sequences

>1021|AJ243209.1|AJ243209|MLS|Macrolide_resistance_efflux_pumps|MSRC
GCAAATGGTGTAGGTAAGACAACTTTATTAGAACATATCCGCAAACAAGGAGAAGGAATCCTTCTCTCTCCGAAAGTAAG
CTTTCAAGTATATCAGCAAAAGGGTTATCAAATGACATCTGAAGAATCCATCATTCGTTTTGTCATGAGACAAACAGAGT
TTTCAGAATCGCTTGTCCGTAGTTTGCTGAATCACTTAGGGGTTGCTCAGGAAACTCTGACGAAACCGTTATGTACATTA
AGTGGGGGAGAAGCGACCCGTCTGACGATTGCTTTGCTTTTTACTAAGCCAAGTAATGTGTTGCTGTTAGATGAACCGAC
TAATTTTATTGATATGGCAACGATCGAAGCTTTAGAGAAGCTAATGCAAATATATCCGGGAACGATTTTGTTTACATCAC
ATGAT

>MLS|msrC_2_AF313494|MLS|Macrolide_resistance_efflux_pumps|MSRC
ATGGAAAATTTAGCAGTAAATATAACAAACCTGCAAGTTCGTTTTGGTAACCAGTTAGAATTATCTATTGATTCTCTTCG
TGTCTATCAGCAAGATCGGATAGGAATCATAGGGGAAAATGGAGTCGGTAAAACAACGTTGCTGAAACTGATAGTCGGTG
AACTTATCCCCAATCAAGGGAAAATCCAAACAGAGATCACTTTCAACTATCTGCCTCAATTAACCTATCTTGCTGAGGCA
AAGGACCTAAATTTGGAATTAGCCAGTCATTTCCAGTTGAAACTGGAAGAAACTTCGGAACGGAAATGGAGTGGAGGGGA
AGAACGAAAGATCGAGTTGATACGTCTTCTTTCTTCTTATGAACAAGGGATGCTTCTAGACGAGCCGACAACCCATCTAG
ATAGAAAAAGTATGGATCGACTAATTGAAGAGCTTCGTTATTATTATGGCACGCTGATTTTTGTTAGTCATGACCGCTAT
TTTCTAGATGAGTTGGCAACGAAAGTCTGGGAAGTAAAAGACGGAGAAATCCGAGAGTTTCCGGAGAATTATAGTGCCTA
TCTCACTCAAAGGGAATTGGAGAAAAAGACTCAGCTACGAGAAGCAGAGTCGATCATGAAAGAGAAAAAACGATTGGAAA
AATCGATCCAAGAAAAGAAAAAACAAGCGGAAAAGTTAGAAAAAGTGTCCAGTAAAAAGAAAAAGCAACAAATCAGACCG
GATCGGTTGTCTTCCTCTAAACAAAAAGACAGTGTACAAAAAGCCATCCAAAAGAATACGAAAACATTAGAGAGAAGACT
CCAAAAAATAGGAGAAACAACCAAACCGCAACAGATGAAACAAATCCGTTTTCCAGTACCAAAATCTCTTGAACTCCACA
ATCGTTATCCAATCATGGGACAAAATATCCAATTGGAAAGAAGCGGAAGAACATTACTGATAAATAGCGATTTTCAATTT
TCTTTAGGTAAAAAAATCGCGATTGTCGGCGAAAATGGATCAGGTAAGACAACTTTATTGGAACATATCCGCAAACAAGG
AGAAGGAATCCTTCTCTCTCCGAAAGTAAGCTTTCAAGTATATCAGCAAAAGGATTATCAAATGACATCTGAAGAATCCG
TCATTCGTTTTGTCATGAGACAAACAGAGTTTTCGGAATCACTTGTCCGCAGTTTGTTGAATCATTTAGGGTTTGCTCAG
GAAACTCTGACGAAACCGTTGTGTACGTTAAGTGGGGGAGAAGCGACTCGTTTGACGATTGCTTTGCTTTTTACTAAGCC
AAGTAATGTGTTGCTGTTAGATGAACCGACTAATTTCATTGATGTGGCAACGATCGAAGCTTTAGAGCAGCTGATGCAAG
TATATCCGGGAACGATTTTGTTTACTTCACATGATTCCTACTTTGTCGAGCGTACGGCTGATGAAGTTTATGAAATAAAA
GGGCAGAAAATAAAAAAAGTACTTACGAGAAATTTTTAA

>MLS|MsrC|AY004350|496-1974|1479|MLS|Macrolide_resistance_efflux_pumps|MSRC
ATGGAAAATTTAGCAGTAAATATAACAAATCTACAAGTCAGCTTTGGCAACCAGCTAGAACTATCTATTGATTCTCTTCG
TGTCTATCAGCAAGATCGTATAGGGATCATAGGAGAAAATGGTGTCGGTAAATCGACTTTGCTCAAACTAATAGCCGGTG
AACTTTTTCCCGATCATGGGAAAATCCAAACAGAGATCACCTTCAACTACCTGCCTCAATTAACCTATCTCGCTGAAGCA
AAGGACCTAAATTTGGAATTAGCCAGTCATTTCCAGTTAAGACTGGAAGAAACTTCAGAGCGGAAATGGAGCGGAGGGGA
AGAACGAAAGATCGAGTTGATACGTCTTCTTTCTTCTTATGAACAAGGGATGCTTCTAGACGAGCCAACAACCCATCTAG
ATAGAAAAAGTATTGATCGACTGATTGAAGAGCTTCGTTATTATTATGGTACGCTGGTTTTTGTTAGTCATGATCGCTAT
TTTCTAGATGAGCTAGCATCGAAAATCTGGGAAGTAAAAGACGGAGAAATCCGAGAGTTTTCGGGGAATTATAGTGCCTA
TCTCACTCAAAAGGAATTGGAGAAAAAGACTCAGCTACGAGAAGCAGAGTCGATCATGAAAGAGAAAAAACGATTGGAAA
AATCGATCCAAGAAAAGAAAAAACAAGCGGAAAAGTTGGAAAAAGTGTCCAGTAAAAAGAAAAAGCAACAAATCAGACCG
GATCGGTTGTCTTCCTCTAAACAAAAAGACAGTGTACAAAAAGCCATCCAAAAGAATGCGAAAACATTAGAGAGAAGACT
CCAAAAAATAGGAGAAACAACCAAGCCGCAGCAGATGAAACAAATCCGTTTTCCAGTACCAAAATCTCTTGAACTCCACA
GCCGCTATCCCATCATGGGACAAAATGTCCAATTGGAAAGAAGTGGGAGAACATTACTGGTAAATGGTGATTTTCAGTTT
TCTTTAGGTAAAAAAATCGCGATTGTCGGTGAAAATGGTTCAGGTAAGACAACCTTATTGGAACATATCCGCAAACAAGG
AGAAGGAATCCTTCTCTCTCCGAAAGTAAGCTTTCAAGTCTATCAGCAAAAGGATTATCAAATGACATCTGAAGAATCCG
TCATTCGTTTTGTCATGAGACAAACAGAGTTTTCGGAATCGCTTGTCCGCAGTTTGCTGAATCACTTAGGGTTTGCTCAG
GAAACTCTGGCGAAACCGTTGTGTACGTTAAGTGGGGGAGAAGCGACCCGTTTGATGATTGCTTTGCTTTTTACTAAGCC
AAGTAATGTGTTGCTGTTAGATGAACCGACTAATTTCATTGATATGGCAACGATCGAAGCTTTAGAGAAGCTGATGCAAG
TATATCCGGGAACGATTTTGTTTACTTCTCATGATTCTTACTTTGTCGAGCGTACGGCTGATGAAGTTTATGAAATAAAA
GGGCAGAAAATAAAAAAAGTACTTACGAGAAATTTTTAA