MEGAResFrom MEG, the Microbial Ecology Group

MEFB

The mefB gene encodes an efflux pump that has been shown to function on macrolides.

References

Other Groups in Macrolide resistance efflux pumps

Sequences

Download Sequences

>CARD|phgb|FJ196385|11083-12313|ARO:3003107|mefB|MLS|Macrolide_resistance_efflux_pumps|MEFB
TCAGTCCACTTGCGGTTTCATTGTTACTTTGTCATAGCGTCGTGTCAGAATGCGGCAGAGAACAGCGTTTACTATCAACG
CAACACCAGACCAGAAAAACCATGTATTAACACCTATAACCTCAACAACCGGACCTGCAACAAGTAAGCCTATCGGCATA
GAAAGAGTCATGGCGGTCATCAAAAGGGAAAACACCTTGCCCATCATTTCAGGGGCAATGCTTTCTTGAACATAAGCCAT
AACAGGAACATTCATAAATGTGCCAGAGGCGCCCAAGAAGAAGCAGCATATAACAAATATCCAAAAACCGCTTGTCGGTA
GCGCTCCGCTAATCAGTGTAGCCAGACCCATTAAGCCAATAGCTAAGGATGCCATGAAAAACCTTCTTTTCATGCCGCCC
CATACACCGATAACCAAAGATGAAAGAAGCAATCCACCTGCAAAGACAAATTCCACAATGCTATTGTGCCAGGCTTCACC
CATAAAGTGGCTGCGTGCCAGTAGAGGGAACAGAGAACCTAATGGCATATAAAGTATGGTCATCAGCAGCATGGGGGAAA
ACACAGCCATTAAAGGTTTATTTGCTTTCATTGCGATAAAGCCCTGCTTCATGTCAGACAATACACTCATCTTCTCATTG
GTTTGCGTAATGTCTGGAATTATAACAAATAGGAGGCAAACTATCGCAAAAGCGGCTCCCAGTATATCCACAATCATAAT
GGAGGAAATAGGTAGAAATGACATAAGCGCAGCACCCAGCACAGGCCCCATCATGTTGGATATTGATTGGATCATATTTC
CCCAGCCCCCTGCTTTGGTCAACATATCTGCTGGCACAAACATGGGTATCGCCGCTTGCATAGCTGGACCGTGAAAGGTA
TTCCCCAATCCACGCAAAAATAAAACAATGTAGATAAACCAAATAGGGGGTGTTTCCACAAGTAAAAATGCTGCCCCAAG
GATGATGCTGGATACAGCTACCAGACCGTCAGCTAAAATCATTACTGTTCGGCGGTTGTATCGGTCGATCCACACACCGG
CAAAGGGTCCGATTAACATATTGGGGAGAAAGGCAACTAAGGATGCAATCGTCAAGGTGATTGCGGATTCAGTCTGGATG
GTCAGCCACCAGATAACAGCGAACTGCACTGCGGCAGAACCCAAGATTGAAAAAGCCTGCCCTGTGTATATTACAGCAAA
TTGTTTCTTCCAATTTTTTATTCTGTTCATT

>235|unknown_id|unknown_name|MLS|Macrolide_resistance_efflux_pumps|MEFB
ATGAACAGAATAAAAAATTGGAAGAAACAATTTGCTGTAATATACACAGGGCAGGCTTTTTCAATCTTGGGTTCTGCCGC
AGTGCAGTTCGCTGTTATCTGGTGGCTGACCATCCAGACTGAATCCGCAATCACCTTGACGATTGCATCCTTAGTTGCCT
TTCTCCCCAATATGTTAATCGGACCCTTTGCCGGTGTGTGGATCGACCGATACAACCGCCGAACAGTAATGATTTTAGCT
GACGGTCTGGTAGCTGTATCCAGCATCATCCTTGGGGCAGCATTTTTACTTGTGGAAACACCCCCTATTTGGTTTATCTA
CATTGTTTTATTTTTGCGTGGATTGGGGAATACCTTTCACGGTCCAGCTATGCAAGCGGCGATACCCATGTTTGTGCCAG
CAGATATGTTGACCAAAGCAGGGGGCTGGGGAAATATGATCCAATCAATATCCAACATGATGGGGCCTGTGCTGGGTGCT
GCGCTTATGTCATTTCTACCTATTTCCTCCATTATGATTGTGGATATACTGGGAGCCGCTTTTGCGATAGTTTGCCTCCT
ATTTGTTATAATTCCAGACATTACGCAAACCAATGAGAAGATGAGTGTATTGTCTGACATGAAGCAGGGCTTTATCGCAA
TGAAAGCAAATAAACCTTTAATGGCTGTGTTTTCCCCCATGCTGCTGATGACCATACTTTATATGCCATTAGGTTCTCTG
TTCCCTCTACTGGCACGCAGCCACTTTATGGGTGAAGCCTGGCACAATAGCATTGTGGAATTTGTCTTTGCAGGTGGATT
GCTTCTTTCATCTTTGGTTATCGGTGTATGGGGCGGCATGAAAAGAAGGTTTTTCATGGCATCCTTAGCTATTGGCTTAA
TGGGTCTGGCTACACTGATTAGCGGAGCGCTACCGACAAGCGGTTTTTGGATATTTGTTATATGCTGCTTCTTCTTGGGC
GCCTCTGGCACATTTATGAATGTTCCTGTTATGGCTTATGTTCAAGAAAGCATTGCCCCTGAAATGATGGGCAAGGTGTT
TTCCCTTTTGATGACCGCCATGACTCTTTCTATGCCGATAGGCTTACTTGTTGCAGGTCCGGTTGTTGAGGTTATAGGTG
TTAATACATGGTTTTTCTGGTCTGGTGTTGCGTTGATAGTAAACGCTGTTCTCTGCCGCATTCTGACACGACGCTATGAC
AAAGTAACAATGAAACCGCAAGTGGACTGA