MEGAResFrom MEG, the Microbial Ecology Group

MEFA

The mefA gene encodes an efflux pump that has been shown to function on macrolides.

References

Other Groups in Macrolide resistance efflux pumps

Sequences

Download Sequences

>MLS|NC_023287.1.18156494|MLS|Macrolide_resistance_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACTTAAGTTTTATACAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CCTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACTGGATCTGCGATGGTCTTGTCTATGGCTTCACTAGTAGGTT
TTTTACCCTATGCGGTCTTTGGACCTGCAATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCT
GATTTAATTATCGCAGCAGCTGGTGCAGTGCTTGCTATTGTTGCATTCTATATGGAGCTACCTGTCTGGATGGTTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCATACCCCAGCACTCAATTCGGTTACACCACTTTTAGTACCAGAAG
AGCAGCTAACGAAATGCGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCAGTTGCAGCACTC
TTATACTCCGTTTGGGATTTAAATGCTATTATTGCCATCGACGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATACCTAAGCTGGGTAATCAAGTGCAAAGTTTGGAACCAAATTTCATAAGAGAAATGAAAGAAGGAATTGTCG
TTCTGAGACAAAACAAAGGATTGTTTGCCTTATTACTCTTAGGAACACTATATACTTTTGTTTATATGCCAATTAATGCA
CTATTTCCTTTAATAAGCATGGAATACTTTAATGGAACACCTGTGCATATTTCTATTACGGAAATTTCCTTTGCCTTTGG
AATGCTAGCAGGAGGCTTATTGTTAGGAAGATTAGGGAGCTTCGAAAAGCGTGTATTACTAATAACTAGTTCATTTTTTA
TAATGGGGGCCAGTTTAGCCGTTTCGGGAATACTTCCTCCAAATGGATTTGTAATATTTGTAGTTTGCTGTGCAATAATG
GGGCTTTCGGTGCCATTTTATAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTGACCGGAAGTATCATGTCACTTGCTATGCCAATTGGATTAATTCTTTCTGGATTCTTTGCTGATAGAATTG
GTGTAAATCATTGGTTTTTACTATCAGGTATTTTAATTATTGGCATTGCTATAGTTTGCCCAATGATAACAGAGGTTAGA
AAATTAGATTTAAAATAA

>MLS|MefA|U70055|314-1531|1218|MLS|Macrolide_resistance_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACTTAAGTTTTATACAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CTTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACTGGATCCGCGATGGTCTTGTCTATGGCTTCACTATTAGGTT
TTTTACCCTATGCGGTCTTTGGACCTGCAATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCT
GATTTAATTATCGCAGCAGCTGGTTCGGTGCTTACTATTGTTGCATTCTATATGGAGCTACCTGTCTGGATGGTTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCACACCCCGGCTCTCAATGCGGTTACGCCACTTTTAGTACCAGAAG
AACAGCTTACGAAATGTGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCGGTTGCAGCACTC
TTATACTCCGTTTGGGAACTAAATGCTATTATTGCCATCGATGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATTCCTAAGCTGGGTGATCGCGTGCAAAGTTTGGACCCAAATTTCATAAGAGAAATGCAAGAAGGAATGGCTG
TACTACGGCAAAATAAAGGATTATTTGCTTTATTACTCGTTGGAACATTATATATGTTTGTTTATATGCCAATTAATGCA
CTATTCCCTTTAATTAGCATGGATTACTTTAATGGAACACCTGTGCATATTTCTATTACGGAAATTTCCTTTGCATCTGG
AATGTTGATAGGGGGTCTATTATTAGGGTTATTTGGGAATTACCAAAAGCGAATCTTATTAATAACGGCATCCATTTTTA
TGATGGGGATAAGCTTAACCATTTCAGGATTACTTCCCCAAAGTGGATTTTTCATTTTTGTAGTCTGCTGTGCAATAATG
GGGCTTTCTGTTCCGTTTTACAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTAACTGGAAGTATCATGTCTCTTGCTATGCCAATTGGATTAATTCTTTCTGCACTCTTTGCTGATAGAATCG
GTGTAAATCATTGGTTTTTACTATCAGGTACTTTAATTATTTGCATTGCAATAGTTTGCCCAATGATAAATGAGATTAGA
AAATTAGATTTAAAATAA

>CARD|phgb|NC_023287|65291-66509|ARO:3000615|mefA|MLS|Macrolide_resistance_efflux_pumps|MEFA
TTATTTTAAATCTAATTTTCTAACCTCTGTTATCATTGGGCAAACTATAGCAATGCCAATAATTAAAATACCTGATAGTA
AAAACCAATGATTTACACCAATTCTATCAGCAAAGAATCCAGAAAGAATTAATCCAATTGGCATAGCAAGTGACATGATA
CTTCCGGTCAAAGAAAATACACGTCCTAAATATTCAGGCTTAATTTTCTCCTGAAAAAGAGCTGTTTGCACACCGCTATA
AAATGGCACCGAAAGCCCCATTATTGCACAGCAAACTACAAATATTACAAATCCATTTGGAGGAAGTATTCCCGAAACGG
CTAAACTGGCCCCCATTATAAAAAATGAACTAGTTATTAGTAATACACGCTTTTCGAAGCTCCCTAATCTTCCTAACAAT
AAGCCTCCTGCTAGCATTCCAAAGGCAAAGGAAATTTCCGTAATAGAAATATGCACAGGTGTTCCATTAAAGTATTCCAT
GCTTATTAAAGGAAATAGTGCATTAATTGGCATATAAACAAAAGTATATAGTGTTCCTAAGAGTAATAAGGCAAACAATC
CTTTGTTTTGTCTCAGAACGACAATTCCTTCTTTCATTTCTCTTATGAAATTTGGTTCCAAACTTTGCACTTGATTACCC
AGCTTAGGTATACGTACAATTGCTACCGTAATAGATGCAATCACAGCACCCAATACGTCGATGGCAATAATAGCATTTAA
ATCCCAAACGGAGTATAAGAGTGCTGCAACTGCCGGACTAACAATATAGCTTATAGACTGCAAAGACTGACTATAGCCTG
CGCATTTCGTTAGCTGCTCTTCTGGTACTAAAAGTGGTGTAACCGAATTGAGTGCTGGGGTATGAAAAGCTGTTCCAATG
CTACGGATAAACAATACTATCATAACCATCCAGACAGGTAGCTCCATATAGAATGCAACAATAGCAAGCACTGCACCAGC
TGCTGCGATAATTAAATCAGCACCAATCATTATCTTCTTCCTATCATGACGATCCACTAGCACACCAATTGCAGGTCCAA
AGACCGCATAGGGTAAAAAACCTACTAGTGAAGCCATAGACAAGACCATCGCAGATCCAGTTTTTTCTGTAAGGTAAAAA
ATAATCGCCATTTGCAGGATGGCACTAGTGATTAATGATACTGCTTGCCCTGCCCATATTGTATAAAACTTAAGTTTCCA
ATTGTTGTATTTTTCCATT

>MLS|NC_003098.1.933922|MLS|Macrolide_resistance_efflux_pumps|MEFA
TTGAAAATAGATAAAAAAAACGAGGCTTTCCTTATTGTAAGTAGAGGCATATCTCGAATTGGAGATATTATGTTTGACTT
TGCGAATAATACCTTTCTTGCAGGATTAAATCCAACATCTTTATCATTGGTTGCAGTATATCAGTCACTAGAAAGTGTGA
TAGGTGTTCTTTTTAATTTATTTGGTGGAGTCATTGCAGATAGTTTCAAGCGGAAAAAAATTATTATTGTTGCAAATATC
TTATGTGGTATTGCTTGTATAATTCTTTCATTCATATCACAAGAGCAGTGGATGGTCTTTGCAATTGTCATCACTAATAT
TATCTTGGCATTTATGAGTGCTTTTTCTGGACCGTCCTATAAAGCATTTACAAAAGAAATTGTAAAAAAGGATAGTATAT
CACAACTTAATTCATTGCTAGAGATAACAAGTACTATAATTAAAGTAACAATACCAATGGTAGCAATTTTATTATATAAG
CTACTTGGGATACATGGTGTTTTACTATTGGATGGATTCTCATTTCTAATTGCTGCATCACTGATTTCCTTTATTGTACC
CGTTAATGACGAAGTGGTCACAAAGGATAAAATGACAATAGGAGGAGTTTTAAATGACTTAAAAATAGGGTTTAAGTATA
TTTATAGTCATAAGACAATATTTATGATTATTATTCTCTCTGCTTTTGTTAATTTTTTTCTAGCAGCTTATAATTTATTG
TTACCTTATAGTAATCAAATGTTTGGAGAAATTTCAGATGGGCTTTATGGTGTTTTTCTAACTGCGGAAGCAATTGGAGG
ATTTATTGGAGCGATATTAAGTGGTGTTATAAATAAAACCTTGTCAAGCAAACGTTTAATGGTCTTCTTATCATGTTCAG
GATTGATGTTAATGCTATCAACGCCACTCTATTTTTTGTTTCAAAACTTCATTATTCTAGCCTTTTCTCCGGCATTATTT
AGTCTATTTATTTCTATTTTTAATATTCAATTTTTCTCTATTGTTCAAAGAGAAGTTGATACTGAGTTTCTCGGTAGAGT
CTTTGGAATCATCTTTACGGTAGCTATTCTTTTTATGCCAGTTGGGTCTGGATTTTTCTCAGTAGTTTTAAATCCTAACA
ATACTTTTAATCTTTTTATTATTGGTGTATCTATTACGATATTATCGCTAATATTCAGCACGCTATTGAAGAGGTATGAT
AAAAATAGCTGA

>MLS|mefA_10_AF376746|MLS|Macrolide_resistance_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACGAAAATTTTATGCAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CCTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACAGGATCTGCGATGGTCTTGTCTATGGCTTCATTAGTAGGTT
TTTTACCCTATGCGATTTTGGGACCTGCCATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCC
GATTTAATTATCGCAGCAGCTGGTGCAGTGCTTGCTATTGTTGCATTCTGTATGGAGCTACCTGTCTGGATGATTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCATACCCCAGCACTCAATGCGGTTACACCACTTTTAGTACCAGAAG
AACAGCTAACGAAATGCGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCAGTTGCAGCACTC
TTATACTCCGTTTGGGATTTAAATGCTATTATTGCCATCGACGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATACCTAAGCTGGGTAATCAAGTGCAAAGTTTAGAACCAAATTTCATAAGGGAGATGAAAGAAGGAGTTGTGG
TTCTGAGACAAAACAAAGGATTGTTTGCCTTATTACTCTTAGGAACACTATATACTTTTGTTTATATGCCAATCAATGCA
CTATTTCCTTTAATAAGCATGGAACACTTTAATGGAACGCCTGTGCATATTTCTATTACGGAAATTTCCTTTGCATTTGG
GATGCTAGCAGGAGGCTTATTATTAGGAAGATTAGGGGGCTTCGAAAAGCATGTATTACTAATAACAAGTTCATTTTTTA
TAATGGGGACCAGTTTAGCCGTTTCGGGAATACTTCCTCCAAATGGATTTGTAATATTCGTAGTTTGCTGTGCAATAATG
GGGCTTTCGGTGCCATTTTATAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTGATCGGAAGTATCATGTCACTTGCTATGCCAATTGGGTTAATTCTTTCTGGATTCTTTGCTGATAAAATCG
GTGTAAATCATTGGTTTTTACTATCAGGTATTTTAATTATTGGCATTGCTATAGTTTGCCAAATGATAACTGAGGTTAGA
AAATTAGATTTAAAATAA