MEGAResFrom MEG, the Microbial Ecology Group

MACB

The macB gene encodes an efflux pump that has been shown to function on macrolides.

References

Other Groups in Macrolide resistance efflux pumps

Sequences

Download Sequences

>44|AY768532.1|AY768532|MLS|Macrolide_resistance_efflux_pumps|MACB
ATGAGCTTGATCGAATGTAAAAACATCAACCGCTATTTCGGCAGCGGCGAGAACCGCGTCCATATTTTGAAAGACATCAG
CCTGTCGATAGAGAAGGGTGATTTTGTCGCCATCATCGGGCAGTCCGGTTCGGGCAAGTCCACGCTGATGAACATACTCG
GTTGTTTGGATACCGCCGGTTCCGGTTCGTACCGAATCGACGGCATCGAAACTGCCAAAATGCAGCCTGACGAACTGGCG
GCATTGCGGCGCGAACGCTTCGGTTTCATCTTCCAACGCTACAACCTCTTAAGCTCGCTGACCGCAAGGGACAACGTCGC
GCTGCCAGCCGTGTATATGGGTATGGGAGGCAAAGAGCGTTCCGCGCGGGCGGACAAACTCTTGCAGGATTTGGGTTTGG
CAAGTAAAGAGGGCAACAAGCCCGGCGAACTCTCGGGCGGACAGCAGCAGCGCGTCTCCATCGCCCGCGCCCTGATGAAC
GGCGGAGAAATCATCTTCGCCGACGAGCCGACCGGCGCACTCGATACCGCCAGCGGCAAAAATGTGATGGAAATCATCCG
CAGGCTGCACGAAGCCGGGCATACCGTCATTATGGTCACGCACGACCCCGGCATTGCCGCCAATGCCAACCGCGTCATCG
AAATCCGGGACGGCGAAATCATTTCCGACACCTCGAAAAATCCCGAAATCCCCGCAAGCAATGTCGGGAGGATTCAGGAA
AAAGCCTCGTGGTCGTTTTATTACGACCAGTTTGTCGAAGCCTTCAGAATGTCGGTGCAAGCAGTATTGGCGCACAAAAT
GCGTTCGCTTCTGACCATGCTCGGCATCATCATCGGTATCGCTTCGGTTGTCTCCGTCGTCGCGCTGGGCAACGGGTCGC
AGAAAAAAATCCTCGAAGACATCAGTTCGATGGGGACGAACACCATCAGCATCTTCCCCGGGCGCGGCTTCGGCGACAGG
CGCAGCGGCAAAATCAAAACCCTGACCATAGACGACGCAAAAATCATCGCCAAACAAAGCTATGTTGCTTCCGCCACGCC
CATGACTTCGAGCGGCGGCACGCTGACCTACCGCAATACCGACCTGACCGCTTCTTTGTACGGCGTGGGCGAACAATATT
TCGACGTGCGCGGGCTGAAGCTGGAAACGGGGCGGCTGTTTGATGAGAACGATGTGAAAGAAGACGCGCAAGTCGTCGTC
ATCGACCAAAATGTCAAAGACAAACTCTTTGCGGACTCGGATCCGTTGGGTAAAACCATTTTGTTCAGGAAACGCCCCTT
GACCGTCATCGGCGTGATGAAAAAAGACGAAAACGCTTTCGGCAATTCCGACGTGCTGATGCTTTGGTCGCCCTATACGA
CGGTGATGCACCAAATCACAGGCGAGAGCCACACCAACTCCATCACCGTCAAAATCAAAGACAATGCCAATACCCGGGTT
GCCGAAAAAGGGCTGGCCGAGCTGCTCAAAGCACGGCACGGCACGGAAGACTTCTTTATGAACAACAGCGACAGCATCAG
GCAGATGGTCGAAAGCACCACCGGTACGATGAAGCTGCTGATTTCCTCCATCGCCCTGATTTCATTGGTAGTCGGCGGCA
TCGGCGTGATGAACATTATGCTGGTGTCCGTTACCGAGCGCACCAAAGAAATCGGCATACGGATGGCAATCGGCGCGCGG
CGCGGCAATATTTTGCAGCAGTTTTTGATTGAGGCGGTGTTAATCTGCATCATCGGAGGCTTGGTCGGCGTAGGTTTGTC
CGCCGCCGTCAGCCTCGTGTTCAATCATTTTGTAACCGATTTCCCGATGGACATTTCGGCGGCATCCGTTATCGGGGCGG
TCGCCTGTTCGACCGGAATCGGCATCGCGTTCGGCTTTATGCCTGCCAATAAGGCAGCCAAACTCAATCCGATAGACGCA
TTGGCGCAGGATTGA