MEGAResFrom MEG, the Microbial Ecology Group

CARA

The carA gene encodes an efflux pump that has been shown to function on macrolides.

References

Other Groups in Macrolide resistance efflux pumps

Sequences

Download Sequences

>CARD|phgb|M80346|0-1656|ARO:3002817|carA|MLS|Macrolide_resistance_efflux_pumps|CARA
GTGTCGACAGCGCAACTAGCTCTGCATGACATCACCAAGCGTTACCAGGACCACGTCGTACTCGACCGGATCGGCTTCAC
CATCAAGCCGGGCGAGAAGGTCGGTGTCATCGGGGACAACGGATCCGGCAAGTCCACGCTGATCAAGCTCATCGCCGGGC
GGGAACAGCCGGACAACGGTGCGGTGACGGTGGTCGCGCCCGGTGGCGTCGGCTATCTGGCCCAGACACTGGAGCTGCCG
CTGGAGGCCACGGTCCAGGACGCCGTCGATCTGGCCCTGGCCGACCTGCGGGAGCTGGAGGAGGGCATGCGCCGGACCGA
GGCCGAGCTGGCCGAACGGCCCTACCAAACGGGCCAAGACCCCGAACTCGCCGGCCTCCTGGAGAGTTACGCCGCGCTGG
TGGACCGGTATCAGGCCCGCGGCGGCTACGAGGCCGACTCCCGCGTGGAGATCGCGCTGCACGGGCTCGGGCTGCCCGGG
CTGGAACGCGGCCGGCGGCTGGGCACCCTGTCCGGCGGCGAGCGCTCGCGCCTCGCCCTGGCGGCGACGCTGGCCTCGGA
ACCCGAACTGCTGCTGTTGGACGAGCCGACCAACGACCTGGACGACCGGGCCGTGGACTGGCTGGAGGAACACCTGCGCA
AGCACAAAGGCACCGTTGTCGCCGTTACCCACGACCGGCTCTTCCTCGACCGGCTCACCACCACGATCCTGGAGATCGAC
TCCGGCAAGGTGATGCGCTACGGCAACGGCTACGAGGGCTACCTGGCAGCCAAGGCGGCGGAACGGCAGCGCAGGCTGCT
TGAGTACGAGCAGTGGCGCGCCGAGCTGGACCGCAGCCGCGACCTGATCGCGTCCAACGTGGCGCGTCTGGACGCCATCC
CACGCAAGCTGCCCTTCGCCGTCTTCGGCGCCGGCCAGTTCCGGATGCGCGGGCGGGGCCATGGTGCGATGGTGCGGATC
CGCAACGCCAAGGAACGCGTCGCGCGGCTGACCGAAAACCCGGTCGCGCCGCCGCCCGAGCCGCTCACCTTCACCGCGGA
GATCACCACCGAGGCCGCGCAGTCCCGGGAGACGGTGGCCGAACTCACCGGCGTCCGGGTCGGCGACCGGCTCAGCGTCG
ACTCCCTGCACCTCGGGCCCGGTGAACGGCTGCTGGTCACCGGCCCCAACGGGGCGGGCAAGACGACGCTGCTGCGGGTG
CTCTCCGGGGAGCTGGAACCCGACAGCGGATCCCTGCTGGTGTCGGGCCGGGTGGGACACCTGAGGCAGGAACAGACACC
ATGGCGGCCGGGTATGACGGTGCTTCAGGCGTTCAGCAGCGGACGGGCCGGTGACATCGACGAGCACACCGAGGCGCTGC
TCTCCCTCGGGCTGTTCAGCCCGGACGACCTCCGCCAGCGTGTGCAGGACCTGTCGTACGGGCAGCGGCGCCGCATCGAG
CTTGCCCGGCTGGTGACGGAGCCGGTCGACCTGCTGCTGCTGGACGAACCCACCAACCACCTCTCGCCCGCGCTCGTCGA
GGAACTGGAGGAGGCGCTGACCGGTTATCAGGGCACGGTCGTCGTCGTCACCCACGACCGGCGCATGCGGTCCCGCTTCA
ACGGCGCCCATCTGACGCTGCAGGACGGGCGCGTCGCCGAGTTCACCGCCGCCTGA