Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MPHE

The mph genes encode macrolide phosphotransferases that have been shown to confer resistance to erythromycin by inactivation of the antibiotic molecule via phosphorylation.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC94651/

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Macrolide phosphotransferases

Sequences

Download Sequences

>>MEG_4042|Drugs|MLS|Macrolide_phosphotransferases|MPHE
ATGACAATTCAAGATATTCAATCACTTGCTGAAGCACACGGCTTGTTGATTACGGACAAAATGAATTTCAATGAAATGGG
CATTGATTTTAAGGTCGTTTTTGCTCTTGATACAAAGGGGCAACAATGGTTGCTGCGTATTCCTCGTCGTGATGGCATGA
GGGAACAAATCAAGAAAGAAAAACGCATTTTAGAATTGGTAAAAAAACATCTTTCTGTAGAGGTTCCTGATTGGAGAATT
TCATCTACAGAATTAGTGGCTTATCCCATACTTAAAGATAATCCTGTTTTAAATTTGGATGCTGAAACCTATGAAATAAT
TTGGAATATGGACAAAGATAGCCCGAAATACATAACATCTTTGGCAAAAACCTTATTTGAAATCCATAGTATTCCTGAAA
AAGAAGTTCGGGAAAATGATTTGAAAATTATGAAACCTTCAGATTTAAGACCTGAAATAGCAAACAATTTGCAGTTAGTA
AAATCTGAAATTGGTATAAGTGAGCAATTGGAAACCCGCTACAGAAAATGGTTGGATAATGATGTTCTATGGGCAGATTT
CACCCAATTTATACATGGCGATTTATATGCTGGGCATGTACTAGCTTCAAAGGATGGAGCTGTTTCAGGCGTTATTGATT
GGTCAACAGCCCATATAGATGACCCAGCGATTGATTTTGCTGGGCATGTAACTTTGTTTGGAGAAGAAAGCCTCAAAACT
CTAATCATCGAGTATGAAAAACTAGGGGGTAAAGTTTGGAATAAACTATATGAACAGACTTTAGAAAGAGCAGCGGCCTC
TCCTTTGATGTATGGTTTATTTGCCTTAGAAACTCAAAATGAAAGCCTTATCGTTGGAGCAAAAGCTCAGTTGGGAGTTA
TATAA

>>MEG_4043|Drugs|MLS|Macrolide_phosphotransferases|MPHE
ATGCTGCACGACACGGACCGAATACTGAAGCTGGCCAGGGAGGCAGGCTTGGAGCTTGCGCCCGGTTCCCTTAGGCTCAA
CGAAATGGGCCTCGATTTCCAAGTTGCTTTCGGCAGGGATGGGGACGCTGTAGAGTGGGTTTTGCGGATGCCGCGCCGGA
CGGACGTGGCATGTGCGGCAGTCAAGGAAGCGAAGATACTCGACTATTTCCGCAGTCGGCTGCCAGTCGCTGTGCCGGAC
TGGAAGGTCTTTAGCGATGATCTCATCGCCTACCCCTCCCTGCCGGGCAATCCGGGGCTGACATTTGACGCCTCGACCTA
TGAGACGACCTGGCACTTTGACCAGAATTCTCCGGTCTATGTTGAAACGCTGGGCGCGGCGCTCGCGCAATTGCATGGGC
TCGACACCGACGATGCAATTAGCGCGGGGCTAAGCAATCTCAGTATCGATGCCGTACGAGAGAACTGGACGCGCGATCTC
GAAACTGTCGAGAAAAGCTTTGAGGTACCGGCAGCAAGACTTGCCCTCTGGCGCGCTTGGCTTGCTGACTTGTCATTCTG
GCCTACCCATGCCGCCTCAGTGCACGGCGATCTTTATGTCGGGCATGTCATGGTCAAATCGGACGGTACTGTCTGCGGGA
TAATCGACTGGAGTGAGGCTCATATCGGCGATCCTGGAATCGATCTGGCTGGACATCTCAAGGTGTTCGGCGAAGCTAGC
CTGCGCGACCTCCTCGGTCACTACGAGGCGGCGGGGGGACAAACCTGGCCGCGTATAGTTGAGCATTGCAAGATGCTGCA
GAGCGCCGAGGGCATCCGATATGCTATGTTCGCCCTTAAGACGGGCAGCGCAGAGCATCTGGAGGGTGCCCAGGGGCTTT
TGTCGGCGCCAGGGATTTGA

>>MEG_4044|Drugs|MLS|Macrolide_phosphotransferases|MPHE
ATGACAATTCAAGATATTCAATCACTTGCTGAAGCACACGGCTTGTTGCTTACGGACAAAATGAATTTCAATGAAATGGG
CATTGATTTTAAGGTCGTTTTTGCTCTTGATACAAAGGGGCAACAATGGTTGCTGCGTATTCCTCGTCGTGATGGCATGA
GGGAACAAATCAAGAAAGAAAAACGCATTTTAGAATTGGTAAAAAAACATCTTTCTGTAGAGGTTCCTGATTGGAGAATT
TCATCTACAGAATTAGTGGCTTATCCCATACTTAAAGATAATCCTGTTTTAAATTTGGATGCTGAAACCTATGAAATAAT
TTGGAATATGGACAAAGATAGCCCGAAATACATAACATCTTTGGCAAAAACCTTATTTGAAATCCATAGTATTCCTGAAA
AAGAAGTTCGGGAAAATGATTTGAAAATTATGAAACCTTCAGATTTAAGACCTGAAATAGCAAACAATTTGCAGTTAGTA
AAATCTGAAATTGGTATAAGTGAGCAATTGGAAACCCGCTACAGAAAATGGTTGGATAATGATGTTCTATGGGCAGATTT
CACCCAATTTATACATGGCGATTTATATGCTGGGCATGTACTAGCTTCAAAGGATGGAGCTGTTTCAGGCGTTATTGATT
GGTCAACAGCCCATATAGATGACCCAGCGATTGATTTTGCTGGGCATGTAACTTTGTTTGGAGAAGAAAGCCTCAAAACT
CTAATCATCGAGTATGAAAAACTAGGGGGTAAAGTTTGGAATAAACTATATGAACAGACTTTAGAAAGAGCAGCGGCCTC
TCCTTTGATGTATGGTTTATTTGCCTTAGAAACTCAAAATGAAAGCCTTATCGTTGGAGCAAAAGCTCAGTTGGGAGTTA
TATAA