MEGAResFrom MEG, the Microbial Ecology Group

OLEI

The oleI gene encodes a macrolide glycosyltransferase that inactivates macrolides via transfer of a glucose molecule to the antibiotic.

References

Other Groups in Macrolide glycosyltransferases

Sequences

Download Sequences

>202|DQ195535.2|DQ195535|MLS|Macrolide_glycosyltransferases|OLEI
ATGACGAGCGAGCACCGCTCTGCCTCCGTGACACCCCGTCACATCTCCTTCTTCAACATCCCCGGCCACGGCCACGTGAA
CCCGTCACTCGGCATCGTCCAGGAACTGGTCGCGCGCGGCCACCGGGTCAGCTACGCCATCACCGACGAGTTCGCCGCAC
AGGTCAAGGCGGCCGGCGCGACGCCCGTGGTGTACGACTCCATCCTGCCGAAGGAGTCCAACCCCGAGGAGTCGTGGCCG
GAGGACCAGGAGTCCGCGATGGGCCTGTTCCTCGACGAAGCCGTCCGGGTCCTGCCGCAGCTGGAGGACGCCTACGCCGA
CGACCGGCCGGACCTGATCGTCTACGACATCGCCTCCTGGCCCGCCCCGGTGCTCGGCCGGAAGTGGGACATCCCCTTCG
TCCAGCTCTCCCCGACCTTCGTCGCCTACGAGGGCTTCGAGGAGGACGTACCCGCGGTGCAGGACCCCACGGCCGACCGC
GGCGAGGAGGCCGCCGCCCCCGCGGGGACCGGGGACGCCGAGGAGGGTGCCGAGGCCGAGGACGGCCTGGTGCGCTTCTT
CACCCGGCTCTCGGCCTTCCTGGAGGAGCACGGGGTGGACACCCCGGCCACCGAGTTCCTCATCGCGCCCAACCGCTGCA
TCGTCGCGCTGCCGCGCACCTTCCAGATCAAGGGCGACACGGTCGGCGACAACTACACCTTCGTCGGTCCCACCTACGGC
GACCGGTCCCACCAGGGCACCTGGGAAGGCCCCGGGGACGGGCGTCCGGTGCTGCTGATCGCCCTGGGCTCGGCGTTCAC
CGACCACCTCGACTTCTACCGCACCTGCCTGTCCGCCGTCGACGGCCTGGACTGGCACGTGGTGCTCTCCGTGGGCCGCT
TCGTCGACCCCGCGGACCTCGGCGAGGTCCCGCCGAACGTCGAGGTGCACCAGTGGGTGCCGCAGCTCGACATCCTGACC
AAAGCCTCCGCGTTCATCACGCACGCGGGCATGGGCAGCACCATGGAGGCCCTGTCGAACGCGGTGCCCATGGTCGCGGT
GCCGCAGATCGCGGAGCAGACGATGAACGCCGAGCGGATCGTCGAGCTGGGCCTCGGCCGGCACATCCCGCGGGACCAGG
TCACGGCCGAGAAGCTGCGCGAGGCCGTGCTCGCCGTCGCCTCCGACCCCGGTGTCGCCGAACGGCTCGCGGCCGTCCGG
CAGGAGATCCGTGAGGCGGGCGGCGCCCGGGCGGCCGCCGACATCCTGGAGGGCATCCTCGCCGAAGCAGGCTGA