MEGAResFrom MEG, the Microbial Ecology Group

MGT

The mgt gene encodes a macrolide glycosyltransferase that inactivates macrolides via transfer of a glucose molecule to the antibiotic.

References

Other Groups in Macrolide glycosyltransferases

Sequences

Download Sequences

>MLS|DQ195536.2|orf0|gene|MLS|Macrolide_glycosyltransferases|MGT
ATGACCACCCAGACCACTCCCGCCCACATCGCCATGTTCTCCATCGCCGCCCACGGCCATGTGAACCCCAGCCTGGAGGT
GATCCGTGAACTCGTCGCCCGCGGCCACCGGGTCACGTACGCCATTCCGCCCGTCTTCGCCGACAAGGTGGCCGCCACCG
GCGCCCGGCCCGTCCTCTACCACTCCACCCTGCCCGGCCCCGACGCCGACCCGGAGGCATGGGGAAGCACCCTGCTGGAC
AACGTCGAACCGTTCCTGAACGACGCGATCCAGGCGCTCCCGCAGCTCGCCGATGCCTACGCCGACGACATCCCCGATCT
CGTCCTGCACGACATCACCTCCTACCCGGCCCGCGTCCTGGCCCGCCGCTGGGGCGTCCCGGCGGTCTCCCTCTCCCCGA
ACCTCGTCGCCTGGAAGGGTTACGAGGAGGAGGTCGCCGAGCCGATGTGGCGCGAACCCCGGCAGACCGAGCGCGGACGG
GCCTACTACGCCCGGTTCGAGGCATGGCTGAAGGAGAACGGGATCACCGAGCACCCGGACACGTTCGCCAGTCATCCGCC
GCGCTCCCTGGTGCTCATCCCGAAGGCGCTCCAGCCGCACGCCGACCGGGTGGACGAAGACGTGTACACCTTCGTCGGCG
CCTGCCAGGGAGACCGCGCCGAGGAAGGCGGCTGGCAGCGGCCCGCCGGCGCGGAGAAGGTCGTCCTGGTGTCGCTCGGC
TCGGCGTTCACCAAGCAGCCCGCCTTCTACCGGGAGTGCGTGCGCGCCTTCGGGAACCTGCCCGGCTGGCACCTCGTCCT
CCAGATCGGCCGGAAGGTGACCCCCGCCGAACTGGGGGAGCTGCCGGACAACGTGGAGGTGCACGACTGGGTGCCGCAGC
TCGCGATCCTGCGCCAGGCCGATCTGTTCGTCACCCACGCGGGCGCCGGCGGCAGCCAGGAGGGGCTGGCCACCGCGACG
CCCATGATCGCCGTACCGCAGGCCGTCGACCAGTTCGGCAACGCCGACATGCTCCAAGGGCTCGGCGTCGCCCGGAAGCT
GGCGACCGAGGAGGCCACCGCCGACCTGCTCCGCGAGACCGCCCTCGCTCTGGTGGACGACCCGGAGGTCGCGCGCCGGC
TCCGGCGGATCCAGGCGGAGATGGCCCAGGAGGGCGGCACCCGGCGGGCGGCCGACCTCATCGAGGCCGAACTGCCCGCG
CGCCACGAGCGGCAGGAGCCGGTGGGCGACCGACCCAACGGTGGGTGA

>MLS|DQ185434.2|gene1|MLS|Macrolide_glycosyltransferases|MGT
ATGAAGCGAAAAGAGTTGCACGAGACGTCTCGTCTCGCATACGGTCGTCGCATGACCACTCGCCCCGCGCACATCGCCAT
GTTCTCCATCGCCCTGCACGGCCACGTGAACCCCAGCCTGGAGGTCATCCGCGAGCTCGTCGCGCGGGGGCACCGGGTGA
CGTACGCGATCCCGCCGCTCCTCGCGGACAAGGTCGCCGAGGCGGGCGCCGAACCCAAGCTCTGGAACAGCACACTGCCC
GGCCCCGACGCCGACCCGGAGGCCTGGGGGAGCACCCTCCTGGACAACGTGGAGCCCTTCCTCGCCGACGCGATCCAGTC
GCTCCCGCAGCTCGCCCAGGCGTACGAGGGGGACGAGCCGGACCTGGTCCTGCACGACATCGCCTCCTACACCGCCCGCG
TCCTGGGCCGCCGCTGGGAGGTGCCCGTGATCTCCCTGTCGCCCTGCATGGTCGCCTGGGAGGGGTACGAGCAGGAGGTC
GGCGAGCCGATGTGGGAGGAGCCGCGGAAGACCGAGCGCGGGCAGGCGTACTACGCCCGCTTCCACGCCTGGCTGGAGGA
GAACGGGATCACCGACCACCCCGACCCGTTCATCGGCCGCCCCGACCGCTCCCTGGTGCTGATCCCCAAGGCGCTCCAGC
CCCACGCCGACCGGGTGGACGAGACGACGTACACCTTCGTCGGCGCCTGCCAGGGGGACCGCACCGCCGAGGGCGACTGG
GCCCGTCCCGAGGGCGCGGAGAAGGTCGTCCTGGTCTCGCTCGGTTCGGCCTTCACCAAGCAGCCCGCGTTCTACCGGGA
GTGCGTCCGGGCCTTCGGTGAGCTGCCCGGCTGGCACACCGTGCTCCAGGTCGGCCGGCACGTAGACCCGGCCGAGCTGG
GCGACGTACCGGACAACGTGGAAGTCCGCACGTGGGTACCGCAGTTGGCGATCCTCCAGCAGGCCGACCTGTTCGTCACC
CACGCGGGCGCGGGCGGCAGCCAGGAGGGTCTGGCCACCGCCACGCCGATGATCGCCGTACCGCAGGCCGCGGACCAGTT
CGGCAACGCCGACATGCTCCAGGGCCTCGGCGTCGCCCGCACCCTCCCGACCGAGGAGGCCACCGCGAAGGCGCTGCGCA
CCGCCGCCCTCGCCCTGGTCGACGACCCGGAGGTGGCGGCGCGCCTGAAGGAGATCCAGGCGCGGATGGCCCAGGAGGGC
GGCACCCGCCGGGCCGCCGACCTCATCGAGGCCGAACTGGCCGCCGCGCGCGGCTGA

>MLS|M74717.1|gene2|MLS|Macrolide_glycosyltransferases|MGT
ATGAAGCGAAAAGAGTTGCACGAGACGTCTCGTCTCGCATACGGTCGTCGCATGACCACTCGCCCCGCGCACATCGCCAT
GTTCTCCATCGCCCTGCACGGCCACGTGAACCCCAGCCTGGAGGTCATCCGCGAGCTCGTCGCGCGGGGGCACCGGGTGA
CGTACGCGATCCCGCGGCTCCTCGCGGACAAGGTCGCCGAGGCGGGCGCCGAACCCAAGCTCTGGAACAGCACACTGCCC
GGCCCCGACGCCGACCCGGAGGCCTGGGGGAGCACCCTCCTGGACAACGTGGAGCCCTTCCTCGCCGACGCGATCCAGTC
GCTCCCGCAGCTCGCCCAGGCGTACGAGGGGGACGAGCCGGACCTGGTCCTGCACGACATCGCCTCCTACACCGCCCGCG
TCCTGGGCCGCCGCTGGGAGGTGCCCGTGATCTCCCTGTCGCCCTGCATGGTCGCCTGGGAGGGGTACGAGCAGGAGGTC
GGCGAGCCGATGTGGGAGGAGCCGCGGAAGACCGAGCGCGGGCAGGCGTACTACGCCCGCTTCCACGCCTGGCTGGAGGA
GAACGGGATCACCGACCACCCCGACCCGTTCATCGGCCGCCCCGACCGCTCCCTGGTGCTGATCCCCAAGGCGCTCCAGC
CCCACGCCGACCGGGTGGACGAGACGACGTACACCTTCGTCGGCGCCTGCCAGGGGGACCGCACCGCCGAGGGCGACTGG
GCCCGTCCCGAGGGCGCGGAGAAGGTCGTCCTGGTCTCGCTCGGTTCGGCCTTCACCAAGCAGCCCGCGTTCTACCGGGA
GTGCGTCCGGGCCTTCGGTGAGCTGCCCGGCTGGCACACCGTGCTCCAGGTCGGCCGGCACGTAGACCCGGCCGAGCTGG
GCGACGTACCGGACAACGTGGAAGTCCGCACGTGGGTACCGCAGTTGGCGATCCTCCAGCAGGCCGACCTGTTCGTCACC
CACGCGGGCGCGGGCGGCAGCCAGGAGGGTCTGGCCACCGCCACGCCGATGATCGCCGTACCGCAGGCCGCGGACCAGTT
CGGCAACGCCGACATGCTCCAGGGCCTCGGCGTCGCCCGCACCCTCCCGACCGAGGAGGCCACCGCGAAGGCGCTGCGCA
CCGCCGCCCTCGCCCTGGTCGACGACCCGGAGGTGGCGGCGCGCCTGAAGGAGATCCAGGCGCGGATGGCCCAGGAGGCC
GGCACCCGCGGGCCCGCCGACCTCATCGAGGCCGAACTGGCCGCCGCGCGCGGCTGA