MEGAResFrom MEG, the Microbial Ecology Group

GIMA

The gimA gene encodes a macrolide glycosyltransferase that inactivates macrolides via transfer of a glucose molecule to the antibiotic.

References

Other Groups in Macrolide glycosyltransferases

Sequences

Download Sequences

>CARD|phgb|AJ223970|796-2050|ARO:3000463|gimA|MLS|Macrolide_glycosyltransferases|GIMA
GTGAGAAGAGGTGATTTGCACGAGACGTATCGTCTTGATTACGCTCCGCACATGCACGATCCCGCTCATATCGCGATGTT
CTCCATCGCCGCGCACGGTCACGTGAACCCCAGCCTGGAAGTGATCCGGGAACTCGTCGCGCGAGGGCACCGGGTGACCT
ACGCGATCCCGCCGCTCTTCGCCGAGAAGGTCGCCGAGACGGGCGCCGAACCCAAGCTGTGGAACAGCACGCTGCCCGGC
CCCGACGCCGACCCGGACGCGTGGGGGACCACACCGCTGGACAACGTCGAGCCGTTCCTCGACGACGCGATCCAGGCGCT
CCCGCAGCTCATCGCGGCGTACGAGGGCGACGAGCCGGACCTGGTCCTGCACGACATCACCTCCTACCCGGCCCGCGTCC
TCGCCCATCGCTGGGGCGTTCCCGCCGTCTCGCTCTCGCCGAACCTGGTCGCCTGGGAGGGGTACGAGGAGGAGGTCGGC
CGGCCGACGTGGGAGGAGCCGCTGAAGACCGAGCGCGGCCGGGCGTACGACGCCCGCTTCCGTGGCTGGCTGAAGGAGAA
CGGGATCACCGAGGACCCCGACCCCTTCGTCGGCCGTCCCGACCGGTCGCTGGTCCTCATCCCGAAGGCGCTCCAGCCGC
ACGCCGACCGGGTCGACGAGAAGACGCACACCTTCGTCGGTGCCTGCCAGGGCGACCGCGCCGCCGAGGGCGACTGGCGG
CGTCCGGAGGGCGCGGAGAAGGTCGTCCTCGTCTCGCTCGGGTCCTCGTTCACCAAGCGGCCGGCGTTCTACCGGGCGTG
CGTCGAGGCGTTCGGCGCGCTGCCCGGCTGGCACGTGGTGCTCCAGGTCGGCCGGCACGTCGACCCCGCCGAGCTGGGCG
ACGTACCGGAGAACGTGGAGGTCCGCTCCTGGGTGCCGCAGCTGGCGATCCTGAAGCAGGCTGACCTGTTCGTCACGCAC
GCGGGCGCGGGCGGCAGCCAGGAGGGCCTCGCCACCGCCACGCCGATAGTGGCGGTACCGCAGGCGGTGGACCAGTTCGG
CAACGCGGACATGCTCCAGGGGCTCGGCGTGGGCCGCCACCTGCCCACCGAGGAAGCCACCGCCGAGGCGCTGCGCGCCG
CCGGGCTCGCCCTGGTCGAGGACCCGGAGGTGGCCCGGCGGCTGAAGGAGATCCAGGCCGGGATGGCCCGGGAGGGCGGC
ACCCGGCGGGCCGCCGACCTGATCGAGGCGGAGCTGGCGGCGGCGAGGACCTGAC