MEGAResFrom MEG, the Microbial Ecology Group

MEFE

The mefE gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

    Other Groups in MLS resistance MFS efflux pumps

    Sequences

    Download Sequences

    >>MEG_3829|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFE
    TTGAAAATAGATAAAAAAAACGAGGCTTTCCTTATTGTAAGTAGAGGCATATCTCGAATTGGAGATATTATGTTTGACTT
    TGCGAATAATACCTTTCTTGCAGGATTAAATCCAACATCTTTATCATTGGTTGCAGTATATCAGTCACTAGAAAGTGTGA
    TAGGTGTTCTTTTTAATTTATTTGGTGGAGTCATTGCAGATAGTTTCAAGCGGAAAAAAATTATTATTGTTGCAAATATC
    TTATGTGGTATTGCTTGTATAATTCTTTCATTCATATCACAAGAGCAGTGGATGGTCTTTGCAATTGTCATCACTAATAT
    TATCTTGGCATTTATGAGTGCTTTTTCTGGACCGTCCTATAAAGCATTTACAAAAGAAATTGTAAAAAAGGATAGTATAT
    CACAACTTAATTCATTGCTAGAGATAACAAGTACTATAATTAAAGTAACAATACCAATGGTAGCAATTTTATTATATAAG
    CTACTTGGGATACATGGTGTTTTACTATTGGATGGATTCTCATTTCTAATTGCTGCATCACTGATTTCCTTTATTGTACC
    CGTTAATGACGAAGTGGTCACAAAGGATAAAATGACAATAGGAGGAGTTTTAAATGACTTAAAAATAGGGTTTAAGTATA
    TTTATAGTCATAAGACAATATTTATGATTATTATTCTCTCTGCTTTTGTTAATTTTTTTCTAGCAGCTTATAATTTATTG
    TTACCTTATAGTAATCAAATGTTTGGAGAAATTTCAGATGGGCTTTATGGTGTTTTTCTAACTGCGGAAGCAATTGGAGG
    ATTTATTGGAGCGATATTAAGTGGTGTTATAAATAAAACCTTGTCAAGCAAACGTTTAATGGTCTTCTTATCATGTTCAG
    GATTGATGTTAATGCTATCAACGCCACTCTATTTTTTGTTTCAAAACTTCATTATTCTAGCCTTTTCTCCGGCATTATTT
    AGTCTATTTATTTCTATTTTTAATATTCAATTTTTCTCTATTGTTCAAAGAGAAGTTGATACTGAGTTTCTCGGTAGAGT
    CTTTGGAATCATCTTTACGGTAGCTATTCTTTTTATGCCAGTTGGGTCTGGATTTTTCTCAGTAGTTTTAAATCCTAACA
    ATACTTTTAATCTTTTTATTATTGGTGTATCTATTACGATATTATCGCTAATATTCAGCACGCTATTGAAGAGGTATGAT
    AAAAATAGCTGA

    >>MEG_3830|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFE
    ATGAATCATTGGAAATCAACTTTGGCCGTGATAGGAATAGGCCAACTCATATCTATTTTAACAAGTACGATTGTTGGCTT
    CTCCATTATTTTTTGGATTAGCAACGAATTTAAATCCCCGACAGCTTTATCTCTGGCTATTTTAGCTGGATTTTTACCAC
    AATTTGTATTAGGCTTGTTTGCCGGGGTCTATGTTGACAGATGGAATCGAAAGAAAACGATGTTTTATTCGGACTTGTTC
    ATCGCGTTCTGTACCCTATGTCTTTTTATTGTGATAACCAAGGGTTATAAAGACCTTTCTTTTTTTTATCTATTGACTGC
    TTGTCGTTCAATAGGCAGTACGTTTCATGCACCTGCTTTACAGGCAAGCATCCCTCTACTGGTTCCCAAGCACCATCTTG
    TCAGGGTATCAGGTTTGTACCATTCCATTCAATCCTTCAGTGAGGTGATAGCTCCCGTTGTAGGGGCAAGCCTCGTTGTT
    TGGCTTCCCATACAGTATATTCTGCTCATAGATGTGATCGGAGCTGTTGCTGCTTGTCTGACCTTACTTTGTGTCCAGAT
    TCCTTCTCTTCAAAAAACGAAAGTTCTTCCAGATTTCAAAAAAGAACTGACGGAATGGTTGCATACCTTGCGGCGTACAA
    TGGGCATTTTGCCTTTATTCGTATGCTTTACGCTGGTGACTTTTGTCCTTATGCCTGTTTTTACGTTATTTCCTTTTATG
    ACGCTTCTGCATTTCAACGGAAACATTTTGCAAATGGGAGTTGTGGAAATGGGTTGGGGCTCAGGGGCATTGTTGGGCGG
    TTTAGTACTTGCCTGTAAGGCTTTGAAAAGCAAGCAAACATTAGTGATGCATACGGCTTATGTGATATTGGGATTGTATC
    TGATTAGCGCCAGTTATTTACCATCAAGCGCATTTATAGGTTTTGTTTGCCTAACATTTACAGGAGGCATAGCCTATTCC
    ATTTACCATGCGCTTTTCATCGCTATTATTCAGCAGAACTTGGCTTCGGACATGCTTGGACGGACTTTTTCTCTCATCTT
    TAGTTTGAGTACCTTTCCATCAATGCTGGGTATCGTAGCTTCAGGATATTGGGTGGAAGCATGGGGTATCACATCCGTCT
    TTATGATCAGCGGATGGGTTATCTTTCTGATTGGAGTGGGTGCAAATTTTATTTCTTCAATCAAGCAGTTGGATAATTAC
    GCATAG