MEGAResFrom MEG, the Microbial Ecology Group

MEFB

The mefB gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in MLS resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_3827|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFB
ATGAACAGAATAAAAAATTGGAAGAAACAATTTGCTGTAATATACACAGGGCAGGCTTTTTCAATCTTGGGTTCTGCCGC
AGTGCAGTTCGCTGTTATCTGGTGGCTGACCATCCAGACTGAATCCGCAATCACCTTGACGATTGCATCCTTAGTTGCCT
TTCTCCCCAATATGTTAATCGGACCCTTTGCCGGTGTGTGGATCGACCGATACAACCGCCGAACAGTAATGATTTTAGCT
GACGGTCTGGTAGCTGTATCCAGCATCATCCTTGGGGCAGCATTTTTACTTGTGGAAACACCCCCTATTTGGTTTATCTA
CATTGTTTTATTTTTGCGTGGATTGGGGAATACCTTTCACGGTCCAGCTATGCAAGCGGCGATACCCATGTTTGTGCCAG
CAGATATGTTGACCAAAGCAGGGGGCTGGGGAAATATGATCCAATCAATATCCAACATGATGGGGCCTGTGCTGGGTGCT
GCGCTTATGTCATTTCTACCTATTTCCTCCATTATGATTGTGGATATACTGGGAGCCGCTTTTGCGATAGTTTGCCTCCT
ATTTGTTATAATTCCAGACATTACGCAAACCAATGAGAAGATGAGTGTATTGTCTGACATGAAGCAGGGCTTTATCGCAA
TGAAAGCAAATAAACCTTTAATGGCTGTGTTTTCCCCCATGCTGCTGATGACCATACTTTATATGCCATTAGGTTCTCTG
TTCCCTCTACTGGCACGCAGCCACTTTATGGGTGAAGCCTGGCACAATAGCATTGTGGAATTTGTCTTTGCAGGTGGATT
GCTTCTTTCATCTTTGGTTATCGGTGTATGGGGCGGCATGAAAAGAAGGTTTTTCATGGCATCCTTAGCTATTGGCTTAA
TGGGTCTGGCTACACTGATTAGCGGAGCGCTACCGACAAGCGGTTTTTGGATATTTGTTATATGCTGCTTCTTCTTGGGC
GCCTCTGGCACATTTATGAATGTTCCTGTTATGGCTTATGTTCAAGAAAGCATTGCCCCTGAAATGATGGGCAAGGTGTT
TTCCCTTTTGATGACCGCCATGACTCTTTCTATGCCGATAGGCTTACTTGTTGCAGGTCCGGTTGTTGAGGTTATAGGTG
TTAATACATGGTTTTTCTGGTCTGGTGTTGCGTTGATAGTAAACGCTGTTCTCTGCCGCATTCTGACACGACGCTATGAC
AAAGTAACAATGAAACCGCAAGTGGACTGA