MEGAResFrom MEG, the Microbial Ecology Group

MEFA

The mefA gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in MLS resistance MFS efflux pumps

Sequences

Download Sequences

>>MEG_3805|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacgaaaattttatgcaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagaaaaaacaggatctgcgatggtcttgtctatggcttcattagtaggtt
ttttaccctatgcgattttgggacctgccattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgcc
gatttaattatcgcagcagctggtgcagtgcttgctattgttgcattctgtatggagctacctgtctggatgattatgat
agtattgtttatccgtagcattggaacagcttttcataccccagcactcaatgcggttacaccacttttagtaccagaag
aacagctaacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcagttgcagcactc
ttatactccgtttgggatttaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtaatcaagtgcaaagtttagaaccaaatttcataagggagatgaaagaaggagttgcgg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaatcaatgca
ctatttcctttaataagcatggaacactttaatggaacgcctgtgcatatttctattacggaaatttcctttgcatttgg
gatgctagcaggaggcttattattaggaagattagggggcttcgaaaagcatgtattactaataacaagttcatttttta
taatggggaccagtttagccgtttcgggaatacttcctccaaatggatttgtaatattcgtagtttgctgtgcaataatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgatcggaagtatcatgtcacttgctatgccaattgggttaattctttctggattctttgctgataaaatcg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagtttgccaaatgataactgaggttaga
aaattagatttaaaataa

>>MEG_3806|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacgaaaattttatgcaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagaaaaaacaggatctgcgatggtcttgtctatggcttcattagtaggtt
ttttaccctatgcgattttgggacctgccattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgcc
gatttaattatcgcagcagctggtgcagtgcttgctattgttgcattctgtatggagctacctgtctggatgattatgat
agtattgtttatccgtagcattggaacagcttttcataccccagcactcaatgcggttacaccacttttagtaccagaag
aacagctaacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcagttgcagcactc
ttatactccgtttgggatttaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtaatcaagtgcaaagtttagaaccaaatttcataagggagatgaaagaaggagttgtgg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaatcaatgca
ctatttcctttaataagcatggaacactttaatggaacgcctgtgcatatttctattacggaaatttcctttgcatttgg
gatgctagcaggaggcttattattaggaagattagggggcttcgaaaagcatgtattactaataacaagttcatttttta
taatggggaccagtttagccgtttcgggaatacttcctccaaatggatttgtaatattcgtagtttgctgtgcaataatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgatcggaagtatcatgtcacttgctatgccaattgggttaattctttctgtttcttttgctgataaaatcg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagtttgccaaatgataactgaggttaga
aaattagatttaaaataa

>>MEG_3807|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacgaaaattttatgcaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagaaaaaacaggatctgcgatggtcttgtctatggcttcattagtaggtt
ttttaccctatgcgattttgggacctgccattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgcc
gatttaattatcgcagcagctggtgcagtgcttgctattgttgcattctgtatggagctacctgtctggatgattatgat
agtattgtttatccgtagcattggaacagcttttcataccccagcactcaatgcggttacaccacttttagtaccagaag
aacagctaacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcagttgcagtactc
ttatactccgtttgggatttaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtaatcaagtgcaaagtttagaaccaaatttcataagagagatgaaagaaggagttgtgg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatactatgccaatcaatgcactatttcct
ttaataagcatggaacactttaatggaacgcctgtgcatatttctattacggaaatttcctttgcatttgggatgctagc
aggaggcttattattaggaagattagggggcttcgaaaagcatgtattactaataacaagttcattttttataatgggga
ccagtttagccgtttcgggaatacttcctccaaatggatttgtaatatttgtagtttgctgtgcaataatggggctttcg
gtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgtattttcttt
gaccggaagtatcatgtcacttgctatgccaattgggttaattctttctggattctttgctgataaaatcggtgtaaatc
attggtttttactatcaggtattttaattattggcattgctatagtttgccaaatgataactgaggttagaaaattagat
ttaaaataa

>>MEG_3808|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagaaaaaactggatctgcgatggtcttgtctttggcttcactagtaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctagttcagtgcttactattgttgcactctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcataacccagcactcaattcggttacaccacttttagtaccagaag
agcagctaacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcacttgcagcactc
ttatactccgtttgggatttaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtaatccagtgcaaagtttggaaccaaatttcataagagagatgagagaaggaattgtgg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgcctatcaatgca
ctgtttcctttgataagcatggaacactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatttgg
aatgctagcaggaggcttattgttaggaagattagggagcttcgaaaagcgtgtattactaataactagttcatttttta
taatgggagccagtttagccgtttcgggaatacttcctccaaatggatttgtaatatttgtagtttgctgtgcaataatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgaccggaagtatcatgtcacttgctatgccaattgggttaattctttctggattctttgctgaaagaatcg
gtgtaaatgattggtttttactatcaggtgttttaattattggcattgccatagcttgccccatgataactgaggttaga
aaattagatttaaaataa

>>MEG_3809|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagagaaaacaggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgcggtctttggacctgcgattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggggcagtgcttgctattgttgcattgtatatggagctacctgtctggatagttatgat
agtattgtttatccgtagcattggaacagcttttcataccccagcactcaatgcggttacgccacttttagtaccagaag
aacagctgacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccagcagttgcagcactc
ctatactccgtttgggatttaaatgctattattgccatcgatgtgttgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcaagtgcaaagtttggaaccaaatttcataagagaaatgaaagaaggaattgtcg
ttatgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaattaatgca
ctatatcctttaatcagcatggaatattttaatggaacaccgatgcatatttctattaccgaaattgcttttgcctctgg
catgctggcaggcggcttgatattaggaagattgggaagttacgaaaagcgtgtacctttaataacaggttcatttttta
tgatgggagctagtttagccattgcaggattacttcctccaagtggatttatcatatttgtagtctgctgtgcaataatg
gggctttcagttccattttacagcggtgtacaaacagcactatttcagcaaaaaatcaagcctgaatatttagggcgtgt
attttccttcaccggtagtatcatgtcacttgcaatgccactagggttaatcctttccgggttctttgctgatagaattg
gtataaaccattggtttttaatatcaggtattttaatcatcggtattgctatagtttgcccgatgatgactgaggttaga
aaattagatttaaaacaaaattcatag

>>MEG_3810|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagagaaaacaggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgcggtctttggacctgcgattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggtgcagtgcttactattgttgcattgtatatggagctacctgtctggatagctatgat
agtattgtttatccgtagcattggaacagcttttcataccccagcactcaatgcggttacgccacttttagtaccagaag
aacagctgacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcagttgcagcactc
ttatactccgtttgggatctaaatgctattattgccatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggacccaaatttcataagagaaatgaaagaaggaattgtcg
ttatgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaattaatgca
ctatatcctttaatcagcatggaatattttaatggaacaccgatgcatatttctattaccgaaattgcttttgcctctgg
catgctggcaggcggcttgatattaggaagattgggaagttacgaaaagcgtgtacctttaataacaggttcatttttta
tgatgggagctagtttagccattgcaggattacttcctccaagtggatttttcatatttgtagtctgctgtgcaataatg
gggctttcagttccattttacagcggtgtacaaacagcactttttcagcaaaaaatcaagcctgaatatttagggcgtgt
attttccttcaccggtagtatcatgtcacttgcaatgccactagggttaatcctttccgggttctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccgatgatgactgaggttaga
aaattagatttaaaataa

>>MEG_3811|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatccgcgatggtcttgtctatggcttcactattaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcacaccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtaatcaagtgcaaagtttagaaccaaatttcataagagagatgaaagaaggagttgtgg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaatcaatgca
ctatttcctttaataagcatggaacactttaatggaacgcctgtgcatatttctattacggaaatttcctttgcatttgg
gatgctagcaggaggcttattattaggaagattagggggcttcgaaaagcatgtattactaataacaagttcatttttta
taatggggaccagtttagccgtttcgggaatacttcctccaaatggatttgtaatattcgtagtttgctgtgcaataatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgaccggaagtatcatgtcacttgctatgccaattgggttaattctttctgcactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3812|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatccgcgatggtcttgtctatggcttcactattaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcacaccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggacccaaatttcataagagaaatgcaagaaggaatggctg
tactacggcaaaataaaggattatttgctttattactcgttggaacattatatatgtttgtttatatgccaattaatgca
ctattccctttaattagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttgatagggggtctattattagggttatttgggaattaccaaaagcgaatcttattaataacggcatccattttta
tgatggggataagcttaaccatttcaggattacttccccaaagtggatttttcatttttgtagtctgctgtgcaataatg
gggctttctgttccgttttacagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttaactggaagtattatgtctcttgctatgccaattggattaattctttctgcactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagttttcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3813|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatccgcgatggtcttgtctatggcttcactattaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgttagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcacaccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgatgtattgggtgctgtgattgcaactattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggacccaaatttcataagagaaatgaaagaaggaatggctg
tactacggcaaaataaaggattatttgctttattactcgttggaacattatatatgtttgtttatatgccaattaatgca
ctattccctttaattagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttgatagggggtctattattagggttatttgggaattaccaaaagcgaatcttattaataacggcatccattttta
tgatggggataagcttaaccatttcaggattacttccccaaagtggatttttcatttttgtagtctgctgtgcaataatg
gggctttctgttccgttttacagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttaactggaagtatcatgtctcttgctatgccaattggattaattctttctgcactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3814|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatccgcgatggtcttgtctatggcttcactattaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgttagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcacaccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggacccaaatttcataagagaaatgaaagaaggaatggctg
tactacggcaaaataaaggattatttgctttattactcgttggaacattatatatgtttgtttatatgcccattaatgca
ctattccctttaattagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttgatagggggtctattattagggttatttgggaattaccaaaagcgaatcttattaataacggcatccattttta
tgatggggataagcttaaccatttcaggattacttccccaaagtggatttttcatttttgtagtctgctgtgcaataatg
gggctttctgttccgttttacagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttaactggaagtatcatgtctcttgctatgccaattggattaattctttctgcactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3815|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatccgcgatggtcttgtctatggcttcactattaggtt
ttttaccctatgcggtctttggaccttcaattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatggttatgat
agtattgtttatccgtagcattggaacagcttttcacaccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggacccaaatttcataagagaaatgaaagaaggaatggctg
tactacggcaaaataaaggattatttgctttattactcgttggaacattatatatgtttgtttatatgccaattaatgca
ctattccctttaattagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttgatagggggtctattattagggttatttgggaattaccaaaagcgaatcttattaataacggcatccattttta
tgatggggataagcttaaccatttcaggattacttccccaaagtggatttttcatttttgtagtctgctgtgcaataatg
gggctttctgttccgttttacagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttaactggaagtatcatgtctcttgctatgccaattggattaattctttctgcactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3816|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaagcagtatcattaatcactagtgccat
cttgcaaatggcgattattttttaccttacagaaaaaactggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgcggtctttggacctgcaattggtgtgctagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggttcggtgcttactattgttgcattctatatggagctacctgtctggatgattatgat
agtattgtttatccgtagcattggaacagcttttcataccccggctctcaatgcggttacgccacttttagtaccagaag
aacagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcactc
ttatactccgtttgggaactaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtattcctaagctgggtgatcgcgtgcaaagtttggaaccaaatttcataagagagatgcaagaaggaatggcgg
tactacggcaaaataaaggattgtttgctttattactcgttggaacattatatatgtttgtttatatgccaattaatgca
ctattccctttaataagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttgatagggggtctattattagggttatttgggaatttccaaaagcgaatcttattaataacggcatccattttta
tgatggggataagcttaaccatttcaggattacttccccaaagtggatttgtcatttttgtagtctgctgtgcaataatg
gggctttctgttccgttttacagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttaactggaagtatcatgtctcttgctatgccaattggattaattctttctggactctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgcattgcaatagtttgcccaatgataaatgagattaga
aaattagatttaaaataa

>>MEG_3817|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaggcagtatcattaatcactagtgccat
cctgcaaatggcgattattttttaccttacagaaaaaacaggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgcggtctttggaccagccattggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggggcagtgcttgctattgttgcattgtatatggagttacctatctggatggttatggt
agtattgtttatccgtagcattggaacagcttttcataccccggctctcaatgcggttacgccacttttagtaccagaag
agcagcttacgaaatgtgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcggttgcagcattg
ttatattctgtttgggaattaaatgctattattgccatcgatgtattgggtgctatgattgcgtctattacggtagcaat
tgtacgtattcctaagctaggcgatcaagtgcaaagcttgaaaccaaatttcataagagaaatgaaagaaggaatggctg
tactacggcaaaataaaggattatttgctttattactcgttggaacattatatatgtttgtttatatgcccataaatgca
ttatatcctttaatcactatggaatattttaatggtacaccgatgcatatttctattacggagattgcttatgcctctgg
tatgttgatagggggtctattattagggttatttgggaattaccaaaagcgaatcttattaataacggcatcaattttta
tgatggggataagcttaaccatttcaggattacttcctcaaagtggatttttcatatttgtagtctgctgtgcaataatg
gggctttcggtgccattctatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgaccggaagtatcatgtcacttgctatgccaattgggttaattctttctggattcattgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattatttgtattgcaatagtttgcccaatgataactgagattaga
aaattagatttaaaacaaaattcatag

>>MEG_3818|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaggcagtttctttaatcactagtgctat
cctgcaaatggcgattattttttaccttacagaaaaaacaggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgctgtctttggacctgccataggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggggcagtgctggctattgttgcattgtatatggagttacctgtctggatggttatggt
agtattgtttatccgcagcgttggaacagcttttcataccccagcactcaatgcagttacgccacttttagtaccagaag
aacagctaacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccagcggttgcagcattg
ttatattctgtttgggaattaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtgatcgagtgcaaagtttggaaccaaatttcataagagaaatgaaagaaggaattgtcg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaattaatgca
ctatttcctttaataagcatggaatactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
catgttagcaggaggcttattgttaggaagattagggagcttcgaaaagcgtgtattactaataactggttcattcttta
taatgggggccagtttagccgtttcaggattacttcctacaagtggatttgtaatatttgtagcttgctgtgcagtaatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgaccggaagtataaagtcacttgctatgccaattggattaattctttctgggttctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagtttgccccatgataactgaggttaga
aaattagatttaaaataa

>>MEG_3819|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaacttaagttttatacaatatgggcagggcaggcagtttctttaatcactagtgctat
cctgcaaatggcgattattttttaccttacagaaagaacaggatctgcgatggtcttgtctatggcttcactagtaggtt
ttttaccctatgctgtctttggacctgccataggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatcgcagcagctggggcagtgctggctattgttgcattgtatatggagttacctgtctggatggttatggt
agtattgtttatccgcagcgttggaacagcttttcataccccagcactcaatgcagttacgccacttttagtaccagaag
agcagcttacgaaatgcgcaggctatagtcagtctttgcagtctataagctatattgttagtccggcagttgcagcactc
ttatactccgtttgggatttaaatgctattattgccatcgacgtattgggtgctgtgattgcatctattacggtagcaat
tgtacgtatacctaagctgggtgatcgagtgcaaagtttggaaccaaatttcataagagaaatgaaagaaggaattgtcg
ttctgagacaaaacaaaggattgtttgccttattactcttaggaacactatatacttttgtttatatgccaattaatgca
ctatttcctttaataagcatggattactttaatggaacacctgtgcatatttctattacggaaatttcctttgcatctgg
aatgttagcaggaggcttattgttaggaagattagggagcttcgaaaaacgtgtattactaataacaagttcatttttta
tcatgggggccagtttagccgtttcgggaatacttcctccaaatggatttgtaatatttgtagtttgctgtgcaataatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgaccggaagtatcatgtcacttgctatgccaattgggttaattctatctgggttctttgctgatagaatcg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagcttgccccatgataactgaggttaga
aaattagatttaaaacaaaattcatag

>>MEG_3820|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatacaacaattggaaatttaagttttatactatatgggcagggcaggcggtatctttaatcactagtgccat
cctgcaaatggcgataattttttaccttacagaaaaaacaggatctgcgatggttttgtctatggcttcactagtagggt
ttttaccctatgcggtctttggaccagccattggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatagcagcagctggagcagtgctcgctattgttgcattgtatacggagttatctgtatggatggttatggt
agtattgtttatccgtagcattggaacggcttttcattctccggctctcaatgcggttacgccgcttttagtaccagaag
aacagcttacgaaatgtgcaggttatagtcagtctttgcagtcgataagttatattattagtccggctgctgcggcattg
ttatactccgtttggaaattaaatgcaattattgctatcgatatattgggtgctatgattgcatctattacggtagcaat
tgtaagtattcctaagctgggcgatcaagtgcaaagtttgaaaccaaatttcttaagagaaatgaaagaaggaattgtcg
cattgagacaaaacaaaggcttatttgccttattactcttaggaacgctatatacgtttgtgtatatgccaattaatgca
ctatttcctttaattagcatggaatattttaatggaacacctgtgcatatttccattaccgaaatcgcttttgcatctgg
aatgctagtaggcggtctactattaggaaggttggggaactttgaaaagcgtgtattgctaataacaggttcattcttta
taatgggagccagtttagccgtttcaggattacttccgccaagtggatttgttatatttgtagcttgctgtgcagtaatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaagattaagcctgaatatttaggacgtgt
attttctttgaccggaagtattatgtcatttgcaatgccaattggattaattctttctggattctttgctgatagaattg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagtttgcccgatgataacagaggttaga
aaattagatttaaaataa

>>MEG_3821|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatatataaactggaaacttaagttttatactatatgggcagggcaggcggtatctttaatcactagtgccat
cctgcaaatggcgataattttttaccttacagaaaaaacaggatctgcgatggttttgtctatggcttcactagtagggt
ttttaccctatgcggtctttggaccagccattggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatagcagcagctggagcagtgctcgctattgttgcattgtatacggagttatctgtatggatggttatggt
agtattgtttatccgtagcattggaacggcatttcattctccggctctcaatgcggttacgccgcttttagtaccagaag
aacagcttacgaaatgtgcaggttatagtcagtctttgcagtcgataagttatattattagtccggcggctgcagcattg
ttatactccgtttggaaattaaatgcaattattgctatcgatgtattgggtgctgtgattgcatctattacggtagcaat
tgtaagtattcctaagctgggcgatcaagtgcaaagtttgaaaccgaatttcttaagagaaatgaaagaaggaattgtcg
cattgagacaaaacaaaggcatatttgccttattactcttaggaacgctatatacgtttgtgtatatgccaattaatgca
ctgtttcctttaattagcatggaatactttaatggaaaacctgtgcatatttcaattaccgaaatcgcttttgcatctgg
aatgctagtaggcggtctaatattaggaaggttgggtaattttgaaaagcgtgtattactaataactggttcattcttta
taatgggggccagtttagtcgtttcaggattacttcctccaagtggatttgttatatttgtagcttgctgtgcagtaatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaaaattaagcctgaatatttaggacgtgt
attttctttgactggaagtattatgtcatttgctatgccaattggattaattctttctgggttctttgctgatagaatcg
gtgtgaatcattggtttttactatcaggtattttaattattggcattgctatagtttgccccatgataacagaggttaga
aaattagattttaaataa

>>MEG_3822|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
atggaaaaatatataaattggaaatttaagttttatactatatgggcagggcaggcggtatctttaatcactagtgccat
cctgcaaatggcgataattttttaccttacagaaaaaacaggatctgcgatggttttgtctatggcttcactagtagggt
ttttaccctatgcggtctttggaccagccattggtgtattagtggatcgtcatgataggaagaagataatgattggtgct
gatttaattatagcagcagctggagcagtgctcgctattgttgcattgtatacggagttatctgtatggatggttatggt
agtattgtttatccgtagcattggaacggcttttcattctccggctctcaatgcggttacgccgcttttagtaccagaag
aacagcttacgaaatgtgcaggttatagtcagtctttgcagtcgataagttatattattagtccggctgctgcggcattg
ttatactccgtttggaaattaaatgcaattattgctatcgatatattgggtgctatgattgcatctattacggtagcaat
tgtaagtattcctaagctgggcgatcaagtgcaaagtttgaaaccaaatttcttaagagaaatgaaagaaggaattgtcg
cattgagacaaaacaaaggcttatttgccttattactcttaggaacgctatatacgtttgtgtatatgccaattaatgca
ctatttcctttaattagcatggaatattttaatggaacacctgtgcatatttccattaccgaaatcgcttttgcatctgg
aatgctagtaggcggtctactattaggaaggttggggaactttgaaaagcgtgtattgctaataacaggttcattcttta
taatgggagccagtttagccgtttcaggattacttccgccaagtggatttgttatatttgtagcttgctgtgcagtaatg
gggctttcggtgccattttatagcggtgtgcaaacagctctttttcaggagaagattaagcctgaatatttaggacgtgt
attttctttgaccggaagtattatgtcatttgcaatgccaattggattaattctttctggattctttgctgatagaattg
gtgtaaatcattggtttttactatcaggtattttaattattggcattgctatagtttgcccgatgataacagaggttaga
aaattagatttaaaataa

>>MEG_3823|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACTTAAGTTTTATACAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CTTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACTGGATCCGCGATGGTCTTGTCTATGGCTTCACTATTAGGTT
TTTTACCCTATGCGGTCTTTGGACCTGCAATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCT
GATTTAATTATCGCAGCAGCTGGTTCGGTGCTTACTATTGTTGCATTCTATATGGAGCTACCTGTCTGGATGGTTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCACACCCCGGCTCTCAATGCGGTTACGCCACTTTTAGTACCAGAAG
AACAGCTTACGAAATGTGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCGGTTGCAGCACTC
TTATACTCCGTTTGGGAACTAAATGCTATTATTGCCATCGATGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATTCCTAAGCTGGGTGATCGCGTGCAAAGTTTGGACCCAAATTTCATAAGAGAAATGCAAGAAGGAATGGCTG
TACTACGGCAAAATAAAGGATTATTTGCTTTATTACTCGTTGGAACATTATATATGTTTGTTTATATGCCAATTAATGCA
CTATTCCCTTTAATTAGCATGGATTACTTTAATGGAACACCTGTGCATATTTCTATTACGGAAATTTCCTTTGCATCTGG
AATGTTGATAGGGGGTCTATTATTAGGGTTATTTGGGAATTACCAAAAGCGAATCTTATTAATAACGGCATCCATTTTTA
TGATGGGGATAAGCTTAACCATTTCAGGATTACTTCCCCAAAGTGGATTTTTCATTTTTGTAGTCTGCTGTGCAATAATG
GGGCTTTCTGTTCCGTTTTACAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTAACTGGAAGTATCATGTCTCTTGCTATGCCAATTGGATTAATTCTTTCTGCACTCTTTGCTGATAGAATCG
GTGTAAATCATTGGTTTTTACTATCAGGTACTTTAATTATTTGCATTGCAATAGTTTGCCCAATGATAAATGAGATTAGA
AAATTAGATTTAAAATAA

>>MEG_3824|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACTTAAGTTTTATACAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CCTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACTGGATCTGCGATGGTCTTGTCTATGGCTTCACTAGTAGGTT
TTTTACCCTATGCGGTCTTTGGACCTGCAATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCT
GATTTAATTATCGCAGCAGCTGGTGCAGTGCTTGCTATTGTTGCATTCTATATGGAGCTACCTGTCTGGATGGTTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCATACCCCAGCACTCAATTCGGTTACACCACTTTTAGTACCAGAAG
AGCAGCTAACGAAATGCGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCAGTTGCAGCACTC
TTATACTCCGTTTGGGATTTAAATGCTATTATTGCCATCGACGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATACCTAAGCTGGGTAATCAAGTGCAAAGTTTGGAACCAAATTTCATAAGAGAAATGAAAGAAGGAATTGTCG
TTCTGAGACAAAACAAAGGATTGTTTGCCTTATTACTCTTAGGAACACTATATACTTTTGTTTATATGCCAATTAATGCA
CTATTTCCTTTAATAAGCATGGAATACTTTAATGGAACACCTGTGCATATTTCTATTACGGAAATTTCCTTTGCCTTTGG
AATGCTAGCAGGAGGCTTATTGTTAGGAAGATTAGGGAGCTTCGAAAAGCGTGTATTACTAATAACTAGTTCATTTTTTA
TAATGGGGGCCAGTTTAGCCGTTTCGGGAATACTTCCTCCAAATGGATTTGTAATATTTGTAGTTTGCTGTGCAATAATG
GGGCTTTCGGTGCCATTTTATAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTGACCGGAAGTATCATGTCACTTGCTATGCCAATTGGATTAATTCTTTCTGGATTCTTTGCTGATAGAATTG
GTGTAAATCATTGGTTTTTACTATCAGGTATTTTAATTATTGGCATTGCTATAGTTTGCCCAATGATAACAGAGGTTAGA
AAATTAGATTTAAAATAA

>>MEG_3825|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACGAAAATTTTATGCAATATGGGCAGGGCAAGCAGTATCATTAATCACTAGTGCCAT
CCTGCAAATGGCGATTATTTTTTACCTTACAGAAAAAACAGGATCTGCGATGGTCTTGTCTATGGCTTCATTAGTAGGTT
TTTTACCCTATGCGATTTTGGGACCTGCCATTGGTGTGCTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCC
GATTTAATTATCGCAGCAGCTGGTGCAGTGCTTGCTATTGTTGCATTCTGTATGGAGCTACCTGTCTGGATGATTATGAT
AGTATTGTTTATCCGTAGCATTGGAACAGCTTTTCATACCCCAGCACTCAATGCGGTTACACCACTTTTAGTACCAGAAG
AACAGCTAACGAAATGCGCAGGCTATAGTCAGTCTTTGCAGTCTATAAGCTATATTGTTAGTCCGGCAGTTGCAGCACTC
TTATACTCCGTTTGGGATTTAAATGCTATTATTGCCATCGACGTATTGGGTGCTGTGATTGCATCTATTACGGTAGCAAT
TGTACGTATACCTAAGCTGGGTAATCAAGTGCAAAGTTTAGAACCAAATTTCATAAGGGAGATGAAAGAAGGAGTTGTGG
TTCTGAGACAAAACAAAGGATTGTTTGCCTTATTACTCTTAGGAACACTATATACTTTTGTTTATATGCCAATCAATGCA
CTATTTCCTTTAATAAGCATGGAACACTTTAATGGAACGCCTGTGCATATTTCTATTACGGAAATTTCCTTTGCATTTGG
GATGCTAGCAGGAGGCTTATTATTAGGAAGATTAGGGGGCTTCGAAAAGCATGTATTACTAATAACAAGTTCATTTTTTA
TAATGGGGACCAGTTTAGCCGTTTCGGGAATACTTCCTCCAAATGGATTTGTAATATTCGTAGTTTGCTGTGCAATAATG
GGGCTTTCGGTGCCATTTTATAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAAATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTGATCGGAAGTATCATGTCACTTGCTATGCCAATTGGGTTAATTCTTTCTGGATTCTTTGCTGATAAAATCG
GTGTAAATCATTGGTTTTTACTATCAGGTATTTTAATTATTGGCATTGCTATAGTTTGCCAAATGATAACTGAGGTTAGA
AAATTAGATTTAAAATAA

>>MEG_3826|Drugs|MLS|MLS_resistance_MFS_efflux_pumps|MEFA
ATGGAAAAATACAACAATTGGAAACGAAAATTTTATGCAATATGGGCAGGGCAGGCGGTATCTTTAATCACTAGTGCCAT
CCTGCAAATGGCGATAATTTTTTACCTTACAGAAAAAACAGGATCTGCGATGGTCTTGTCTATGGCTTCACTATTAGGGT
TTTTACCCTATGCGGTCTTTGGACCAGCCATTGGTGTATTAGTGGATCGTCATGATAGGAAGAAGATAATGATTGGTGCT
GATTTAATTATAGCAGTAGCTGGAGCAGTGCTCGCTATTGTTGCATTGTTTACGGAGTTATCTGTATGGATGGTTATGGT
AGTATTGTTTATCCGTAGCATTGGAACGGCTTTTCATTCTCCGGCTCTCAATGCGGTTACGCCGCTTTTAGTACCAGAAG
AACAGCTTACGAAATGTGCAGGTTATAGTCAGTCTTTGCAGTCGATAAGCTATATTATTAGTCCGGCGGCCGCAGCATTG
TTATACTCCGTTTGGAAACTAAATGCAATTATTGCTATCGATGTATTGGGCGCTGTGATTGCATCTATTACGGTAGCAAT
TGTAAGTATTCCTAAGCTGGGCGATCAAGTGCAAAGTTTGAAACCAAATTTCTTAAGAGAAATGAAAGAAGGAATTGTCG
CATTGAGACAAAACAAAGGCTTATTTGCCTTATTACTCTTAGGAACGCTATATACGTTTGTGTATATGCCAATTAATGCA
CTATTTCCTTTAATTAGCATGGAATACTTTAATGGAACACCTGTGCATATTTCCATTACCGAAATCGCTTTTGCATCTGG
AATGCTAGTAGGCGGTCTACTATTAGGAAGGTTGAGGAACTTTGAAAAGCGTGTATTACTAATAACAGGTTCATTCTTTA
TAATGGGAGCCAGTTTAGCAGTTTCAGGATTACTTCCTCCAAGTGGATTTGTTATATTTGTAGCTTGCTGTGCAGTAATG
GGGCTTTCTGTGCCATTTTATAGCGGTGTGCAAACAGCTCTTTTTCAGGAGAAGATTAAGCCTGAATATTTAGGACGTGT
ATTTTCTTTGACCGGAAGTATTATGTCATTTGCTATGCCAATTGGATTAATTCTTTCTGGATTCTATGCTGATAGAATTG
GTGTAAATCATTGGTTTTTACTATCAGGTATTTTAATTATTGGCATTGCTATAGTTTGCCCAATGATAACAGAGGTTAGA
AAATTAGATTTAAAATAA