MEGAResFrom MEG, the Microbial Ecology Group

OLEC

The oleC gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

    Other Groups in MLS resistance ABC efflux pumps

    Sequences

    Download Sequences

    >>MEG_4276|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|OLEC
    GTGACCGTACGGGGGCTGGTCAAGCACTACGGCGAGACCAAGGCGCTGGACGGCGTCGACCTGGACGTGCGCGAGGGCAC
    CGTGATGGGTGTGCTCGGGCCGAACGGCGCCGGCAAGACCACCCTCGTCCGCATCCTGTCCACCCTGATCACCCCGGACT
    CCGGGCAGGCCACCGTGGCCGGCTACGACGTCGTACGCCAGCCCCGGCAGCTGCGCCGGGTCATCGGGCTCACCGGCCAG
    TACGCGTCGGTGGACGAGAAGCTCCCGGGCTGGGAGAACCTCTACCTGATCGGCCGGCTGCTGGACCTGTCCCGCAAGGA
    GGCCCGGGCCCGCGCCGACGAGCTGCTGGAGCGGTTCTCGCTGACCGAGGCCGCCCGGCGCCCGGCCGGCACCTACTCCG
    GCGGTATGCGGCGCCGACTGGACCTGGCCGCCTCGATGATCGGCCGGCCGGCCGTGCTGTACCTGGACGAGCCGACCACC
    GGCCTCGACCCGCGCACCCGCAACGAGGTGTGGGACGAGGTCAAGGCGATGGTCGGCGACGGCGTCACCGTGCTGCTCAC
    CACCCAGTACATGGAGGAGGCCGAGCAGCTCGCCTCGGAACTGACCGTGGTGGACCGCGGCCGGGTCATCGCCAAGGGCG
    GCATCGAGGAGCTGAAGGCCCGCGTCGGCGGGCGCACCCTGCGGGTGCGGCCGGTCGACCCGCTCCAGCTGCGCCCGCTC
    GCCGGCATGCTGGACGAGCTGGGCATCACCGGGCTGGCTTCCACCACCGTGGACACCGAGACCGGGGCCCTGCTGGTGCC
    GATCCTCAGCGACGAGCAGCTGACCGCCGTGGTCGGCGCGGTCACCGCGCGCGGCATCACGCTGTCCTCCATCACCACCG
    AACTGCCCAGCCTGGACGAGGTGTTCCTGTCCCTCACCGGCCACCGCGCCAGTGCCCCGCAGGACGCCGAGCCCGCCCGC
    CAGGAGGTCGCCGTATGA