MEGAResFrom MEG, the Microbial Ecology Group

MSRE

The msrE gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

    Other Groups in MLS resistance ABC efflux pumps

    Sequences

    Download Sequences

    >>MEG_4075|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRE
    ATGAGTTTAATTATTAAAGCGAGAAACATACGCTTGGATTATGCTGGGCGTGATGTTTTGGATATTGATGAATTGGAAAT
    TCACTCTTATGACCGTATTGGTCTTGTGGGTGATAACGGAGCAGGAAAGAGTAGTTTACTCAAAGTACTTAATGGCGAAA
    TTGTTTTAGCCGAAGCGACATTACAGCGTTTTGGTGATTTTGCACATATCAGCCAACTGGGCGGAATCGAAATAGAAACG
    GTCGAAGACCGGGCAATGTTATCTCGCCTTGGTGTTTCCAATGTACAAAACGACACAATGAGTGGCGGAGAGGAAACTCG
    TGCAAAAATTGCTGCCGCATTTTCCCAACAAGTACATGGCATTCTAGCGGATGAACCAACCAGCCACCTTGATCTCAATG
    GAATAGATCTACTTATTGGTCAACTTAAAGCATTTGATGGAGCATTACTTGTTATCAGTCATGACCGATATTTTCTTGAT
    ATGGTTGTAGACAAGATATGGGAGTTAAAAGACGGTAAAATTACGGAATATTGGGGTGGTTACTCGGATTACTTGCGTCA
    AAAAGAAGAAGAGCGACAACACCAAGCCGTAGAATATGAGCTGATGATGAAGGAACGGGAGCGATTAGAATCTGCTGTGC
    AAGAAAAACGCCAGCAAGCTAATCGATTAGACAATAAGAAAAAAGGAGAAAAATCCAAAAACTCTACCGAAAGTGCTGGA
    CGACTTGGGCATGCAAAAATGACTGGCACCAAGCAAAGAAAACTGTATCAGGCAGCTAAGAGTATGGAAAAGCGTTTGGC
    TGCATTAGAAGATATTCAAGCACCAGAGCATTTGCGTTCTATTCGTTTTCGTCAAAGTTCAGCCCTAGAACTGCACAATA
    AGTTCCCGATTACGGCAGATGGTCTGAGCTTAAAATTTGGTAGCCGTACTATCTTTGATGACGCTAACTTTATAATACCG
    CTTGGCGCTAAAGTCGCTATAACTGGATCGAATGGAACAGGGAAAACGTCCTTGTTAAAAATGATATCAGAACGTGCTGA
    TGGATTAACCATATCTCCAAAAGCTGAAATTGGCTACTTTACACAAACAGGATATAAATTTAACACGCATAAATCTGTGC
    TCTCCTTTATGCAGGAAGAGTGCGAGTACACAGTTGCGGAAATTCGTGCAGTATTGGCTTCAATGGGGATCGGAGCGAAT
    GATATTCAAAAAAACTTATCCGACTTATCGGGAGGTGAAATCATCAAACTGCTTTTATCCAAAATGCTTTTAGGAAAATA
    TAATATTTTGCTTATGGATGAACCAGGAAACTATCTTGACCTAAAAAGTATTGCCGCATTAGAAACAATGATGAAGTCCT
    ATGCAGGAACTATTATCTTCGTATCTCATGACAAGCAATTGGTCGATAATATTGCTGACATTATCTACGAGATCAAAGAC
    CACAAAATCATCAAGACTTTTGAGAGAGATTGTTAA