MEGAResFrom MEG, the Microbial Ecology Group

MSRA

The msrA gene encodes an ABC efflux pump that has been shown to function on MLS compounds.

References

  • http://aac.asm.org/content/44/4/967.full

Other Groups in MLS resistance ABC efflux pumps

Sequences

Download Sequences

>>MEG_4065|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
atggaacaatatacaattaaatttaaccaaatcaatcataaattgacagatttacgatcacttaacatcgatcatcttta
tgcttaccaatttgaaaaaatagcacttattgggggtaatggtactggcaaaaccacattactaaatatgattgctcaaa
aaacaaaaccagaacctggaacagttgaaacgaatggcgaaattcaatattttgaacagcttaacatggatgtggaaaat
gattttaacacgttagacggtagtttaatgagtgaactccatatacctatgcatacaaccgacagtatgagtggtggtga
aaaagcaaaatataaattagctaatgtcatatcaaattatagtccgatattacttttagatgaacctacaaatcacttgg
ataaaattggtaaagattatctgaataatattttaaaatattactatggtactttaattatagtaagtcacgatagagca
cttatagaccaaattgctgacacaatttgggatatacaagaagatggcacaataagagtgtttaaaggtaattacacaca
gtatcaaaatcaatatgaacaagaacagttagaacaacaacgtaaatatgaacagtatataagtgaaaaacaaagattgt
cccaagccagtaaagctaaacgaaatcaagcgcaacaaatggcacaagcatcatcaaaacaaaaaaataaaagtatagca
ccagatcgtttaagtgcatcaaaacaaaaaggcacggttgagaaggctgctcaaaaacaagctaagcatattgaaaaaag
aatggaacatttggaagaagttgaaaaaccacaaagttatcatgaattcaattttccacaaaataaaatttatgatatcc
ataataattatccaatcattgcacaaaatctaacattggttaaaggaagtcaaaaactgctaacacaagtacgattccaa
ataccatatggcaaaaatatagcgctcgtaggtgcaaatggtgtaggtaagacaactttacttgaagctatttaccacca
aatagagggaattgattgttctcctaaagtgcaaatggcatactatcgtcaacttgcttatgaagacatgcgtgacgttt
cattattgcaatatttaatggatgaaacggattcatcagaatcattcagtagagctattttaaataacttgggtttaaat
gaagcacttgagcgttcttgtaatgttttgagtggtggggaaagaacgaaattatcgttagcagtattattttcaacgaa
agcgaatacgttaattttggatgaaccaactaattttttagatattaaaacattagaagcattagaaatgtttatgaata
aatatcctggaatcattttgtttacatcacatgatacaaggtttgttaaacatgtatcagataaaaaatgggaattaaca
ggacaatctattcatgatataacttaa

>>MEG_4066|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
atggaacaatatacaattaaatttaaccaaatcaatcataaattgacagatttacgatcacttaacatcggtcatcttta
cgcttaccaatttgaaaaaatagcacttattgggggtaatggtactggcaaaaccacattactaaatatgattgctcaaa
aaacaaaaccagaatctggaacagttgaaacggttggcgaaattcaatattttgaacagcttaacatggatgtggaaaat
gattttaacacgttagacggtagtttaatgagtgaactccatatacctatgcatacaaccgacagtatgagtggtggtga
aaaagcaaaatataaattagctaatgtcatatcaaattatagtccgatattacttttagatgaacctacaaatcacttgg
ataaaattggtaaagattatctgaaaaatattttaaaatattactatggtactttaattatagtaagtcatgatagagca
cttatagaccaaattgctgacacaatttgggatatacaagaagatggcacaataagagtgtttaaaggtaattacacaca
gtatcaaaatcaatatgaacaagaacagttagaacaacaacgtcaatatgaacagtatataagtgaaaaacaaagattgt
cccaagccagtaaagctaaacgaaatcaagcgcaacaaatggcacaagcatcatcaaaacaaaaaaacaaaagtatagca
ccagatcgtttaagtgcatcaaaacaaaaaggcacggttgagaaggctgctcaaaaacaagctaagcatattgaaaaaag
aatggaacatttggaagaagttgaaaaaccacaaagttatcatgaattcaatttcccacaaaataaaatttatgatatcc
ataataattatccaatcattgcacaaaatctaacattggttaaaggaagtcaaaaactgctaacacaagtacgattccaa
ataccatatggcaaaaatatagcgctcgtaggtgcaaatggtgtaggtaagacaactttacttgaagctatttaccacca
aatagagggaattgattgttctcctaaagtgcaaatggcatactatcgtcaacttgcttatgaagacatgcgtgacgttt
cattattgcaatatttaatggatgaaacggattcatcagaatcattcagtagagctattttaaataacttgggtttaaat
gaagcacttgatcgttcttgtaatgttttgagtggtggggaaagaacgaaattatcgttagcagtattattttcaacgaa
agcgaatatgttaattttggatgaaccaactaattttttagatattaaaacattagaagcattagaaatgtttatgaata
aatatcctggaatcattttgtttacatcacatgatacaaggtttgttaaacatgtatcagataaaaaatgggaattaaca
ggacaatctcttcatgatataacttaa

>>MEG_4067|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
ATGGAACAATATACAATTAAATTTAACCAAATCAATCATAAATTGACAGATTTACGATCACTTAACATCGATCATCTTTA
TGCTTACCAATTTGAAAAAATAGCACTTATTGGGGGTAATGGTACTGGCAAAACCACATTACTAAATATGATTGCTCAAA
AAACAAAACCAGAATCTGGAACAGTTGAAACGAATGGCGAAATTCAATATTTTGAACAGCTTAACATGGATGTGGAAAAT
GATTTTAACACGTTAGACGGTAGTTTAATGAGTGAACTCCATATACCTATGCATACAACCGACAGTATGAGTGGTGGTGA
AAAAGCAAAATATAAATTAGCTAATGTCATATCAAATTATAGTCCGATATTACTTTTAGATGAACCTACAAATCACTTGG
ATAAAATTGGTAAAGATTATCTGAATAATATTTTAAAATATTACTATGGTACTTTAATTATAGTAAGTCACGATAGAGCA
CTTATAGACCAAATTGCTGACACAATTTGGGATATACAAGAAGATGGCACAATAAGAGTGTTTAAAGGTAATTACACACA
GTATCAAAATCAATATGAACAAGAACAGTTAGAACAACAACGTAAATATGAACAGTATATAAGTGAAAAACAAAGATTGT
CCCAAGCCAGTAAAGCTAAACGAAATCAAGCGCAACAAATGGCACAAGCATCATCAAAACAAAAAAATAAAAGTATAGCA
CCAGATCGTTTAAGTGCATCAAAACAAAAAGGCACGGTTGAGAAGGCTGCTCAAAAACAAGCTAAGCATATTGAAAAAAG
AATGGAACATTTGGAAGAAGTTGAAAAACCACAAAGTTATCATGAATTCAATTTTCCACAAAATAAAATTTATGATATCC
ATAATAATTATCCAATCATTGCACAAAATCTAACATTGGTTAAAGGAAGTCAAAAACTGCTAACACAAGTACGATTCCAA
ATACCATATGGCAAAAATATAGCGCTCGTAGGTGCAAATGGTGTAGGTAAGACAACTTTACTTGAAGCTATTTACCACCA
AATAGAGGGAATTGATTGTTCTCCTAAAGTGCAAATGGCATACTATCGTCAACTTGCTTATGAAGACATGCGTGACGTTT
CATTATTGCAATATTTAATGGATGAAACGGATTCATCAGAATCATTCAGTAGAGCTATTTTAAATAACTTGGGTTTAAAT
GAAGCACTTGAGCGTTCTTGTAATGTTTTGAGTGGTGGGGAAAGAACGAAATTATCGTTAGCAGTATTATTTTCAACGAA
AGCGAATATGTTAATTTTGGATGAACCAACTAATTTTTTAGATATTAAAACATTAGAAGCATTAGAAATGTTTATGAATA
AATATCCTGGAATCATTTTGTTTACATCACATGATACAAGGTTTGTTAAACATGTATCAGATAAAAAATGGGAATTAACA
GGACAATCTATTCATGATATAACTTAA

>>MEG_4068|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
CTGCTAACACAAGTACGTTTCCAAATACCATATGGCAAAAATATAGCACTCGTAGGTGCAAATGGTGTAGGTAAGACAAC
TTTACTTGAAGCTATTTACCACCAAATAGAGGGAATTGATTGTTCTCCTAAAGTGCAAATGGCATACTATCGTCAACTTG
CTTATGAAGACATGCGTGACGTTTCATTATTGCAATATTTAATGGATGAAACGGATTCATCAGAATCATTCAGTAGAGCT
ATTTTAAATAACTTGGGTTTAAATGAAGCACTTGAGCGTTCTTGTAATGTTTTGAGTGGTGGGGAAAGAACGAAATTATC
GTTAGCAGTATTATTTTCAACGAAAGCGAATATGTTAATTTTGGATGAACCAACTAATTTTTTAGATATTAAAACATTAG
AAGCATTAGAAATGTTTATGAATAAATATCCTGGAATCATTTTGTTTACATCACATGATACAAGGTTTGTTAAACATGTA
TCAGATAAAAAATGGGAATTAACAGGACAATCTATTCATGATATAACTTAA

>>MEG_4069|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
ATGGAACAATATACAATTAAATTTAACCAAATCAATCATAAATTGACAGATTTACGATCACTTAACATCGATCATCTTTA
TGCTTACCAATTTGAAAAAATAGCACTTATTGGGGGTAATGGTACTGGTAAAACCACATTACTAAATATGATTGCTCAAA
AAACAAAACCAGAATCTGGAACAGTTGAAACGAATGGCGAAATTCAATATTTTGAACAGCTTAACATGGATGTGGAAAAT
GATTTTAACACGTTAGACGGTAGTTTAATGAGTGAACTCCATATACCTATGCATACAACCGACAGTATGAGTGGTGGTGA
AAAAGCAAAATATAAATTACGTAATGTCATATCAAATTATAGTCCGATATTACTTTTAGATGAACCTACAAATCACTTGG
ATAAAATTGGTAAAGATTATCTGAATAATATTTTAAAATATTACTATGGTACTTTAATTATAGTAAGTCACGATAGAGCA
CTTATAGACCAAATTGCTGACACAATTTGGGATATACAAGAAGATGGCACAATAAGAGTGTTTAAAGGTAATTACACACA
GTATCAAAATCAATATGAACAAGAACAGTTAGAACAACAACGTAAATATGAACAGTATATAAGTGAAAAACAAAGATTGT
CCCAAGCCAGTAAAGCTAAACGAAATCAAGCGCAACAAATGGCACAAGCATCATCAAAACAAAAAAATAAAAGTATAGCA
CCAGATCGTTTAAGTGCATCAAAAGAAAAAGGCACGGTTGAGAAGGCTGCTCAAAAACAAGCTAAGCATATTGAAAAAAG
AATGGAACATTTGGAAGAAGTTGAAAAACCACAAAGTTATCATGAATTCAATTTTCCACAAAATAAAATTTATGATATCC
ATAATAATTATCCAATCATTGCACAAAATCTAACATTGGTTAAAGGAAGTCAAAAACTGCTAACACAAGTACGATTCCAA
ATACCATATGGCAAAAATATAGCGCTCGTAGGTGCAAATGGTGTAGGTAAGACAACTTTACTTGAAGCTATTTACCACCA
AATAGAGGGAATTGATTGTTCTCCTAAAGTGCAAATGGCATACTATCGTCAACTTGCTTATGAAGACATGCGTGACGTTT
CATTATTGCAATATTTAATGGATGAAACGGATTCATCAGAATCATTCAGTAGAGCTATTTTAAATAACTTGGGTTTAAAT
GAAGCACTTGAGCGTTCTTGTAATGTTTTGAGTGGTGGGGAAAGAACGAAATTATCGTTAGCAGTATTATTTTCAACGAA
AGCGAATATGTTAATTTTGGATGAACCAACTAATTTTTTAGATATTAAAACATTAGAAGCATTAGAAATGTTTATGAATA
AATATCCTGGAATCATTTTGTTTACATCACATGATACAAGGTTTGTTAAACATGTATCAGATAAAAAATGGGAATTAACA
GGACAATCTATTCATGATATAACTTAA

>>MEG_4070|Drugs|MLS|MLS_resistance_ABC_efflux_pumps|MSRA
ATGGAAAAATATACAATTAAATTTAACCAAATCAATCATAAGCTGACAGATTTTCGATCCCTTAATATTGAAAATCTTTA
TGCTTATCAATTTGAAAAAATAGCACTTATTGGAGGTAATGGTACTGGCAAAACCACATTACTGAATATGATTGCTCAAA
AAACAAAACCAGAATCTGGAACGGTTGAAACGGATGGCGAAATTCAATATTTTGAACAGCTTAACATGGATGTGGAAAAT
GATTTTAACACGTTAGACGGTAGTTTAATGAGTGAACTCCATATACCTATGCATACAACCGACAGTATGAGTGGTGGTGA
AAAAGCAAAATATAAATTAGCTAATGTCATATCAAATTATAGTCCGATATTACTTTTAGATGAACCTACAAATCACTTGG
ATAAAATTGGTAAAGATTATCTGAATAATATTTTAAAATATTACTATGGTACTTTAATTATAGTAAGTCATGATAGAGCA
CTTATAGACCAAATTGCTGACACAATTTGGGATATACAAGAAGATGGCACAATAAGAGTGTTTAAAGGTAATTACACACA
GTATCAAAATCAATATGAACAAGAACAGTTAGAACAACAACGTCAATATGAACAGTATATAAGTGAAAAACAAAGATTGT
CCCAAGCCAGTAAAGCTAAACGAAATCAAGCGCAACAAATGGCACAAGCATCATCAAAACAAAAAAATAAAAGTATAGCA
CCAGATCGTTTAAGTGCATCAAAACAAAAAGGCACGGTTGAGAAGGCTGCTCAAAAACAAGCTAAGCATATTGAAAAAAG
AATGGAACATTTGGAAGAAGTTGAAAAACCACAAAGTTATCATGAATTCAATTTTCCACAAAATAAAATTTATGATATCC
ATAATAATTATCCAATCATTGCACAAAATCTAACATTGGTTAAAGGAAGTCAAAAACTGCTAACACAAGTACGATTCCAA
ATACCATATGGCAAAAATATAGCGCTCGTAGGTGCAAATGGTGTAGGTAAGACAACTTTACTTGAAGCTATTTATCACCA
AATAGAGGGAATTGATTGTTCTCCTAAAGTGCAAATGGCATACTATCGTCAACTTGCTTATGAAGACATGCGTGACGTTT
CATTATTGCAATATTTAATGGATGAAACGGATTCATCAGAATCATTCAGTAGAGCTATTTTAAATAACTTGGGTTTAAAT
GAAGCACTTGAGCGTTCTTGTAATGTTTTGAGTGGTGGGGAAAGAACGAAATTATCGTTAGCAGTATTATTTTCAACGAA
AGCGAATATGTTAATTTTGGATGAACCAACTAATTTTTTAGATATTAAAACATTAGAAGCATTAGAAATGTTTATGAATA
AATATCCTGGAATCATTTTGTTTACATCACACGATACAAGGTTTGTTAAACATGTATCAGATAAAAAATGGGAATTAACA
GGACAATCTATTCATGATATAACTTAA