MEGAResFrom MEG, the Microbial Ecology Group

LMRA

The lmrA gene encodes a protein that has significant similarities to the methylenomycin-resistance protein (Mmr) of Streptomyces coelicolor. This gene has been implicated in resistance to lincomycin.

References

Sequences

Download Sequences

>CARD|pvgb|AL009126|290131-290698|ARO:3003028|lmrA|MLS|Lincomycin-resistant_lmrA|LMRA|RequiresSNPConfirmation
TTATCTCTTCAGCAGGTCAGGAATGCAGCTGGAGATATGAAGGAGCGGCGTACTGTTTTTTGCCGTCAAAGATAAAAGGA
TGCCGCCTTCAATCATCGCGTTAACCACAGTGCTGGCTTCTTTTGCACGGCTCTCGCTGCAGCCAGTCTGCCGCAGTTTT
TCCTCATACACAGAGGCCCATTCTTTGTAGGCTTCATGACAGGCTTCGCGCAACGGTTCGCTTTTCAATGACGTCTCAGC
CGCTAGCAAGCCCACAGGCAAGCCTTCAATGTCTTCCGTACATGAAAACTGGCAGGAGAGCTCCTTCAAAAAGGCTTGAA
TGCCTTCCGCTGGATCGGTGCAGGCTTCCATGCAGTCCGCGATTTTCTGACGGATATACTCCTTCATCTCATTCACGGCT
TCGATCGCAAGCTGTTCTTTACCCCCGGGAAAGTGGTAGTAAAGAGAGCCTTTAGGCGCGCCGCTTTCCTTTATAATCTG
GTTCAGCCCCGTGCCGTAATACCCTTGCAGCTGAAAAAGCCGGGTAGCTGCCGAAAGGATTTTCTCACGGGAATCTCCAT
AACTCATA