MEGAResFrom MEG, the Microbial Ecology Group

PGSA

The pgsA gene encodes CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase, which participates in the synthesis of components of the phospholipid bilayer. Mutations in this gene have been linked to daptomycin resistance.

References

Sequences

Download Sequences

>CARD|pvgb|NC_003923|1278585-1279164|ARO:3003323|Staphylococcus|Lipopeptides|Daptomycin-resistant_pgsA|PGSA|RequiresSNPConfirmation
ATGAATATTCCGAACCAGATTACGGTTTTTAGAGTAGTGTTAATACCAGTTTTTATATTGTTTGCGTTAGTTGATTTTGG
ATTTGGCAATGTGTCATTTCTAGGAGGATATGAAATAAGAATTGAGTTATTAATCAGTGGTTTTATTTTTATATTGGCTT
CCCTTAGCGATTTTGTTGATGGTTATTTAGCTAGAAAATGGAATTTAGTTACAAATATGGGGAAATTTTTGGATCCATTA
GCGGATAAATTATTAGTTGCAAGTGCTTTAATTGTACTTGTGCAACTAGGACTAACAAATTCTGTAGTAGCAATCATTAT
TATTGCCAGAGAATTTGCCGTAACTGGTTTACGTTTACTACAAATTGAACAAGGATTCGTAAGTGCAGCTGGTCAATTAG
GTAAAATTAAAACAGCAGTTACTATGGTAGCAATTACTTGGTTGTTATTAGGTGATCCATTGGCAACATTGATTGGTTTG
TCATTAGGACAAATTTTATTATACATTGGCGTTATTTTTACTATCTTATCTGGTATTGAATACTTTTATAAAGGTAGAGA
TGTTTTTAAACAAAAATAAA