MEGAResFrom MEG, the Microbial Ecology Group

MPRFD

The mprF gene encodes a bacterial defensin resistance protein. Mutations in this gene have been linked to daptomycin resistance and multi-drug resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3205971/

Other Groups in Daptomycin-resistant mutant

Sequences

Download Sequences

>>MEG_4057|Drugs|Lipopeptides|Daptomycin-resistant_mutant|MPRFD|RequiresSNPConfirmation
ATGAATCAGGAAGTTAAAAACAAAATATTTTCAATCTTAAAAATTACGTTTGCTACAGCTTTATTTATTTTTGTAGCAAT
CACATTGTATCGGGAGTTATCTGGTATTAACTTTAAAGATACGTTGGTTGAATTTAGTAAGATTAACCGTATGTCCTTAG
TGTTACTATTTATTGGTGGTGGGGCATCGCTTGTTATTCTATCAATGTATGATGTGATTTTATCTAGAGCTTTAAAAATG
GATATATCCTTAGGCAAAGTTTTAAGAGTAAGTTATATCATCAATGCATTGAATGCGATTGTAGGTTTCGGTGGCTTTAT
TGGTGCAGGCGTTAGAGCAATGGTTTATAAAAACTATACGCATGATAAAAAGAAATTAGTTCACTTTATATCCTTAATAC
TTATTTCAATGTTGACAGGTTTAAGCTTATTATCATTGCTAATTGTATTCCATGTTTTCGATGCATCTTTAATCTTAGAT
AAGATTACATGGGTAAGATGGGTATTATATGTAGTGTCATTTTTCTTACCATTATTCATTATTTATTCAATGGTTAGACC
ACCCGATAAAAACAATCGTTTTGTAGGATTGTACTGCACTTTAGTGTCGTGTGTTGAATGGTTAGCAGCTGCAGTTGTAT
TATATTTCTGTGGTGTAATTGTTGACGCTCATGTATCATTCATGTCCTTTATTGCAATATTTATCATTGCTGCATTATCA
GGTTTAGTCAGCTTTATTCCTGGTGGTTTCGGCGCTTTCGATTTAGTTGTATTACTAGGATTTAAAACTTTAGGTGTCCC
TGAGGAAAAAGTATTATTAATGCTACTTCTATATCGTTTTGCGTACTATTTTGTACCGGTAATTATTGCATTAATTTTAT
CATCATTTGAATTTGGTACATCAGCTAAGAAGTACATTGAGGGATCTAAATACTTTATTCCTGCTAAAGATGTTACGTCA
TTTTTAATGTCTTATCAAAAGGATATTATTGCTAAAATTCCATCATTATCATTAGCAATTTTAGTATTCTTTACAAGTAT
GATCAACTTAACGATTGTTTACGATGCTTTATATGATGGAAATCACTTAACGTATTATATTCTATTGGCAATTCATACTA
GTGCTTGTTTATTACTTTTACTGAATGTAGTTGGTATTTATAAGCAAAGTAGACGTGCCATTATCTTTGCTATGATTTCA
ATTTTATTAATCACAGTGGCGACATTCTTCACTTACGCTTCATATATTTTAATAACATGGTTAGCTATTATTTTTGTTCT
GCTTATTGTAGCTTTCCGTAGAGCACGTAGGTTGAAACGCCCAGTAAGAATGAGAAATATAGTTGCAATGCTTTTATTCA
GTTTATTTATTTTATATGTTAACCATATATTTATTGCTGGAACGTTATATGCATTAGATATTTATACGATTGAAATGCAT
ACATCTGTATTGCGCTATTACTTCTGGCTTACGATTTTAATCATCGCTATCATCATAGGTATGATTGCATGGTTGTTTGA
TTATCAATTTAGCAAAGTACGTATTTCTTCTAAAATTGAAGATTGCGAGGAGATTATTAATCAGTACGGCGGTAATTATT
TGAGTCACTTGATATATAGTGGTGACAAGCAGTTTTTCACTAATGAAAATAAAACAGCATTTTTAATGTATCGTTATAAA
GCAAGTTCATTAGTGGTTCTTGGAGATCCGTTAGGTGATGAAAATGCCTTTGATGAATTGTTAGAAGCATTCTATAATTA
CGCTGAGTATTTAGGCTATGATGTTATATTCTATCAAGTTACAGATCAACACATGCCTTTATATCATAATTTCGGTAACC
AATTTTTCAAATTAGGTGAAGAAGCAATTATTGATTTAACGCAATTTTCAACTTCAGGTAAAAAACGCCGTGGATTTAGA
GCGACTTTAAATAAATTCGATGAACTTAATATTTCGTTCGAAATTATTGAACCACCGTTTTCAACTGAATTTATAAATGA
ACTTCAACATGTAAGTGATTTATGGCTAGATAATCGTCAGGAAATGCATTTCTCTGTTGGTGAATTTAATGAAGAATACT
TATCTAAAGCGCCAATTGGTGTAATGCGAAATGAAGAAAATGAAGTAATTGCATTTTGTAGTTTAATGCCAACATACTTT
AATGATGCCATTTCAGTCGATTTAATTAGATGGTTGCCAGAGTTAGATTTACCATTAATGGATGGTCTATACTTGCATAT
GTTACTTTGGAGTAAAGAACAAGGTTATACAAAATTTAATATGGGTATGGCAACGTTATCGAACGTTGGTCAATTGCATT
ATTCATATTTAAGAGAACGACTTGCAGGCCGTGTCTTTGAACATTTCAACGGTCTATATCGTTTCCAAGGATTACGTCGT
TATAAATCTAAATATAATCCGAATTGGGAACCACGCTTTTTAGTTTATCGTAAAGATAATTCGCTTTGGGAATCACTTTC
TAAAGTAATGCGTGTAATACGTCACAAATAA