MEGAResFrom MEG, the Microbial Ecology Group

CLS

The cls gene encodes cardiolipin synthetase. Mutations in this gene have been linked with resistance to daptomycin.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/21899450

Other Groups in Daptomycin-resistant mutant

Sequences

Download Sequences

>>MEG_1730|Drugs|Lipopeptides|Daptomycin-resistant_mutant|CLS|RequiresSNPConfirmation
ATGATAGAGTTATTATCCATTGCACTCAAGCATTCTAATATTATTTTAAATTCAATATTTATTGGTGCATTTATTTTAAA
CTTATTATTCGCCTTTACCATTATTTTCATGGAAAGACGTTCTGCCAATTCTATCTGGGCTTGGTTACTAGTCTTAGTTT
TCTTGCCTTTATTCGGCTTCATTTTATACTTACTATTAGGACGACAAATTCAACGTGACCAAATTTTCAAAATTGATAAG
GAAGATAAAAAAGGATTAGAGTTAATCGTTGATGAGCAATTAGCTGCTTTAAAAAATGAAAACTTTTCAAATTCCAATTA
TCAAATTGTAAAATTTAAAGAAATGATTCAAATGTTGTTATATAATAACGCAGCATTTTTAACAACAGACAACGATTTAA
AAATATACACAGACGGCCAAGAAAAATTTGATGACCTAATACAAGACATCCGTAATGCTACTGATTATATTCATTTTCAG
TACTATATTATTCAAAATGATGAATTAGGTCGTACCATTTTAAATGAACTTGGTAAAAAAGCGGAACAAGGTGTAGAAGT
TAAAATTCTTTATGATGACATGGGTTCTCGTGGACTGCGTAAAAAAGGCTTACGCCCGTTTCGCAATAAAGGTGGACATG
CTGAAGCATTTTTCCCATCAAAATTACCTTTAATTAACTTGCGTATGAACAATCGAAACCATCGAAAAATTGTTGTAATA
GATGGGCAAATTGGATATGTTGGTGGTTTTAATGTTGGTGATGAGTACTTAGGTAAATCAAAAAAATTCGGCTATTGGCG
AGATACGCATTTACGAATTGTCGGGGATGCAGTGAATGCATTGCAATTACGATTTATTCTAGATTGGAATTCACAAGCCA
CACGTGACCACATCTCCTATGATGATCGTTATTTCCCAGATGTAAATTCTGGTGGAACAATTGGCGTTCAAATAGCTTCT
AGTGGTCCTGACGAAGAATGGGAACAGATTAAATACGGCTATTTGAAAATGATTTCATCTGCTAAAAAATCGATTTATAT
TCAATCTCCCTATTTCATACCTGATCAAGCCTTTTTAGATTCTATTAAAATTGCGGCATTAGGTGGTGTTGATGTCAATA
TCATGATTCCTAATAAACCTGACCATCCGTTTGTTTTTTGGGCTACTTTAAAAAATGCAGCATCCTTATTAGATGCCGGT
GTTAAAGTATTTCACTACGACAATGGCTTTTTACACTCAAAAACACTTGTTATAGATGATGAAATTGCAAGTGTGGGAAC
AGCTAATATGGACCATCGCAGTTTCACATTGAATTTCGAAGTCAACGCTTTTATTTATGACCAACAAATTGCCAAAAAAT
TAAAACAAGCTTTTATAGATGATTTAGCAGTATCTTCTGAATTAACAAAAGCACGTTATGCTAAGCGAAGTCTTTGGATT
AAATTTAAAGAAGGTATTTCACAATTATTGTCACCTATCTTATAA

>>MEG_1731|Drugs|Lipopeptides|Daptomycin-resistant_mutant|CLS|RequiresSNPConfirmation
TTGATTCTTAGCGTCTTAACAGTTATTTATTTTATTAATGCAATTATTGCGGGAATTACCATTTTGTTAAAACCTCGAGA
TGTAGCAGCAATTTGGGCATGGCTACTCGTACTGATTGCTCTACCCGTTTTTGGTTTTTTCTTATATTTATTCTTTGGTC
GCGGTTTAACCGACAAAAAGAAATTTTATTTGCAACAAAGTGATTTGCGGGAATTAGAGAATTTTCAGAATTTCCAAGAA
GAAAGTTTTGAACTTTATAGTCAAAAGATGCCGACGGAGGAGCAACAACAGTTTACAGACTTTTTTTCCTCGTTAAATAG
GATGCCTCTGACTAAGAAAAATGATGTTGAAATTTTTACGGATGGTACGGAAAAATTCAATGCGTTGATGGCGGATATAA
AAAAAGCTCAGCACTCCATTCATATTGAATATTATGCCTTTGTAACGGATCATATCGGTACCAAAATTTTGAACTTATTA
GAAGAAAAGGCGGCTGAAGGGGTTGAAGTGCGGTTGCTTTACGATGCCTTTGGCTCAAAGGGCACCAAGGTTCATCATTT
GAATGAATTGAAAAAAAACGGTGGTTTTGTCCAAACGTTTATTACTTCTCAAAAAGCACTTTTGAAGTTTCGTTTGAATT
ATCATGATCACCGGAAAATTGTTGTTATTGACGGAAAAGTAGGCTACATTGGCGGCTTTAATGTTGCCGATCAATATGCC
GGAACGACTAAAAAGTTTGGCTATTGGCGGGATACACATTTACGGATTCAAGGGCCAGCAACCTCATTACTGCAAATGCG
TTTTTTAATGGATTGGAACGTCTCTTCCCCCGAGAAAAATCGTGTGGCGTATCAATTGGATTATTTCTTTAAACTTGAAG
CATTGGTGCCAGAGGCAAATACATCCATTCAGATGATTGCCAGTGGTCCTAACAGTGACCGTGAACAAATTAAATTGGCC
TTTATTAAATTGATTACTTCTGCCAAGAAAAGAGTCTGGATTCAAACGCCGTATTTAGTTCCTGATGATAGTGTCTTGGC
TGCTTTAAAGGTTGCTGCGGCTTCAGGAGTAGATGTTAAAATTATGATTCCAGATAAGCCCGACCATCCGTTTATTTATC
GAGCAACACAGTATTACGGCCGCTTATTGATGAAAGAAAATATTGAAATTTTAATTTATAACGGTGGTTTCTTACATGCG
AAAACAATGATTATGGATGATGAAGTCTGCACAGTTGGTTCAGCCAATCAAGATATCCGAAGTTACAAATTAAACTTTGA
AGCAAATGCTGTGTTATATGATAAAAAAATCATTGATCAATTAGAAGCAATTTTCTTAGAAGATCGAAAAAAATGTACAA
CAATGACTCCAGAAGTTGTTCGTGACATGTCAAAATGGTTGATTTTTAAACAACAAATTTCACGATTATTTTCACCAATT
CTTTAA

>>MEG_1732|Drugs|Lipopeptides|Daptomycin-resistant_mutant|CLS|RequiresSNPConfirmation
GTGGTATCTAGTATTATAACCGCCCTTTATCTATTAAATGCACTTATTGCTTTGGTGGCTATTTTGATCAAACCCCGAGA
TGTAGCAGCCATTTGGGCATGGCTCTTAGTATTATTTGCCCTTCCTGGGGTGGGCTTTGTATTATATTTATTTTTCGGAC
GTGGATTAACGGATAAGAAAAAATTCTATCTCCGACAAAGTGACTTGAAAGAATTAGAAAACTTTCAGTCTTTTAGAGGA
GATACCATTGAACATTACGATCCTGACATGGGCGATAAAGACAAACAGCAATTTGTTGACTTCTTCTCTTCATTAAATCG
TATGCCGCTGACAAGAATGAATTCTGTCACTCTTCTCACAGACGGACAAGAGAAATTGGATTCACTGCTTCAAGATCTAA
AAAAAGCCAAACATTCGATCCATATCGAATATTACGCATTTGTGACAGATAATATCGGCCAGCAAGTCTTACATGTTTTA
GAAGAAAAAGCCGCAGAAGGCGTGGAAGTTCGAATATTATATGATGCATTTGGCTCTCATGGCACAAAAGCAAAAGATTT
CAATCGTCTAATCAAAAATGGTGGACATGTCCATACATTTGTTACCTCACAAAGGGCATTACTTCGTTTCCGATTGAATT
ACCATGATCACCGAAAAATCGTTGTGATCGATGGAAAGATTAGTTATACCGGTGGTTTCAATATTGCCAATCAATATGTA
AATACAACAAAAAAATTCGGCTATTGGCGCGATACGCATATACGGATTTTCGGTGCCGCTTCTTCTTTGCTCCAGCTTCG
CTTCTTAACAGACTGGAACGTCTCGGTACCTGAAGAAAAAAAGGTCGGCTATCATTTGAATTATTTCTTTAAAAAAGCAG
ATCGAGATGAATCTAAGCTTGCTGATACATCCATCCAGCTTGTTTCAAGCGGACCGAATAACGAAAGGGAACAAATCAAG
CTTTCATTTATCAAATTGATTACTTCTGCTAAAAAACGTGTTTGGATACAGACACCTTACCTTGTTCCTGATGAAAGTGT
CATTGCTGCTTTAAAAATCGCAACTGCCTCTGGTGTAGATGTGAAAATCATGATTCCCAACAAACCGGATCATCCTTTTA
TTTATCGAGCAACACAATATTATGCTCGGCAGCTGATCAAGGAAAATGTACAAATCCTTGTCTATGAGAACGGCTTCCTC
CATGCAAAAACATTGATAATGGATGATGAAATCTGCATGGTAGGTTCAGCAAATCAAGATATTCGTAGCTACCGATTGAA
TTTTGAAACAAGTGCTGTCATTTACGATCCTGAGTTTTTAGAAGAACTTGCTACTCAGTTCAAAGAAGATGAGACACATT
GTTCATCCATGACAACTGAAACAGTCAAGGAAATGTCTAACTGGCTATTATTCAAGCAACAAATTTCTCGATTATTTTCT
CCAATCCTATAA