MEGAResFrom MEG, the Microbial Ecology Group

RPOCL

The RPOCL group of genes confer resistance to Lipopeptides through the mechanism, Daptomycin-resistant beta-subunit of RNA polymerase RpoC.

References

    Sequences

    Download Sequences

    >>MEG_6139|Drugs|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoC|RPOCL|RequiresSNPConfirmation
    TTGATTGATGTAAATAATTTCCATTATATGAAAATAGGATTGGCTTCACCTGAAAAAATCCGTTCTTGGTCTTTTGGTGA
    AGTTAAAAAACCTGAAACAATCAACTACCGTACATTAAAACCTGAAAAAGATGGTCTATTCTGTGAAAGAATTTTCGGAC
    CTACAAAAGACTGGGAATGTAGTTGTGGTAAATACAAACGTGTTCGCTACAAAGGCATGGTCTGTGACAGATGTGGAGTT
    GAAGTAACTAAATCTAAAGTACGTCGTGAAAGAATGGGTCACATTGAACTTGCTGCTCCAGTTTCTCACATTTGGTATTT
    CAAAGGTATACCAAGTCGTATGGGATTATTACTTGACATGTCACCAAGAGCATTAGAAGAAGTTATTTACTTTGCTTCTT
    ATGTTGTTGTAGATCCAGGTCCAACTGGTTTAGAAAAGAAAACTTTATTATCTGAAGCTGAATTCAGAGATTATTATGAT
    AAATACCCAGGTCAATTCGTTGCAAAAATGGGTGCAGAAGGTATTAAAGATTTACTTGAAGAGATTGATCTTGACGAAGA
    ACTTAAATTGTTACGCGATGAGTTGGAATCAGCTACTGGTCAAAGACTTACTCGTGCAATTAAACGTTTAGAAGTTGTTG
    AATCATTCCGTAATTCAGGTAACAAACCTTCATGGATGATTTTAGATGTACTTCCAATCATCCCACCAGAAATTCGTCCA
    ATGGTTCAATTAGATGGTGGACGATTTGCAACAAGTGACTTAAACGACTTATACCGTCGTGTAATTAATCGAAATAATCG
    TTTGAAACGTTTATTAGATTTAGGTGCACCTGGTATCATCGTTCAAAACGAAAAACGTATGTTACAAGAAGCCGTTGACG
    CTTTAATTGATAATGGTCGTCGTGGTCGTCCAGTTACTGGCCCAGGTAACCGTCCATTAAAATCTTTATCTCATATGTTA
    AAAGGTAAACAAGGTCGTTTCCGTCAAAACCTACTTGGTAAACGTGTTGACTATTCAGGACGTTCAGTTATCGCGGTAGG
    TCCAAGCTTGAAAATGTACCAATGTGGTTTACCGAAAGAAATGGCACTTGAACTATTTAAACCATTTGTAATGAAAGAAT
    TAGTTCAACGTGAAATTGCAACTAACATTAAAAATGCGAAGAGTAAAATCGAACGCATGGATGATGAAGTTTGGGACGTA
    TTGGAAGAAGTAATTAGAGAACATCCTGTATTACTTAACCGTGCACCAACACTTCATAGACTTGGTATTCAAGCATTTGA
    ACCAACTTTAGTTGAAGGTCGTGCGATTCGTCTACATCCACTTGTAACAACAGCTTATAACGCTGACTTTGATGGTGACC
    AAATGGCGGTTCACGTTCCTTTATCAAAAGAGGCACAAGCTGAAGCAAGAATGTTGATGTTAGCAGCACAAAACATCTTG
    AACCCTAAAGATGGTAAACCAGTAGTTACACCATCACAAGATATGGTACTTGGTAACTATTACCTTACTTTAGAAAGAAA
    AGATGCAGTAAATACAGGCGCAATCTTTAATAATACAAATGAAGTGTTAAAAGCATATGCAAATGGCTTTGTACATTTAC
    ACACAAGAATTGGTGTACATGCAAGTTCATTCAACAACCCAACATTTACTGAAGAACAAAACAAAAAGATTCTTGCTACG
    TCAGTAGGTAAAATTATATTCAATGAAATCATTCCGGATTCATTTGCTTATATTAATGAACCTACGCAAGAAAACTTAGA
    AAGAAAGACACCAAACAGATACTTCATCGATCCTACAACTTTAGGTGAAGGTGGATTAAAAGAATACTTTGAAAATGAAG
    AATTAATTGAACCTTTCAACAAAAAATTCTTAGGTAATATTATTGCAGAAGTATTCAACAGATTTAGCATCACTGATACA
    TCAATGATGTTAGACCGTATGAAAGACTTAGGATTCAAATTCTCATCTAAAGCTGGTATTACAGTAGGTGTTGCTGATAT
    CGTAGTATTACCTGATAAGCAACAAATACTTGATGAGCATGAAAAATTAGTCGACAGAATTACAAAACAATTCAATCGTG
    GTTTAATCACTGAAGAAGAAAGATATAATGCAGTTGTTGAAATTTGGACAGATGCAAAAGATCAAATTCAAGGTGAATTG
    ATGCAATCACTTGATAAAACTAACCCAATCTTCATGATGAGTGATTCAGGTGCCCGTGGTAACGCATCTAACTTTACACA
    GTTAGCAGGTATGCGTGGATTGATGGCCGCACCATCTGGTAAGATTATCGAATTACCAATCACATCTTCATTCCGTGAAG
    GTTTAACAGTACTTGAATACTTCATCTCAACTCACGGTGCGCGTAAAGGTCTTGCCGATACAGCACTTAAGACAGCTGAC
    TCAGGATATCTTACTCGTCGTCTTGTTGACGTGGCACAAGATGTTATTGTTCGTGAAGAAGACTGTGGTACAGATAGAGG
    TTTATTAGTTTCTGATATTAAAGAAGGTACAGAAATGATTGAACCATTTATCGAACGTATTGAAGGTCGTTATTCTAAAG
    AAACAATTCGTCATCCTGAAACTGATGAAGTTATCATTCGTCCTGATGAATTAATTACACCTGAAATTGCTAAGAAAATT
    ACAGATGCTGGTATTGAACAAATGTATATTCGCTCAGCATTTACTTGTAACGCAAGACACGGTGTTTGTGAAAAATGTTA
    CGGTAAAAACCTTGCTACTGGTGAAAAAGTTGAAGTTGGTGAAGCAGTTGGTACAATTGCAGCCCAATCTATCGGTGAAC
    CAGGTACACAGCTTACAATGCGTACATTCCATACAGGTGGGGTAGCAGGTAGCGATATCACACAAGGTCTTCCTCGTATT
    CAAGAGATTTTCGAAGCACGTAACCCTAAAGGTCAAGCGGTAATTACGGAAATCGAAGGTGTCGTAGAAGATATTAAATT
    AGCAAAAGATAGACAACAAGAAATTGTTGTTAAAGGTGCTAATGAAACAAGATCATATCTTGCTTCAGGTACTTCAAGAA
    TTATTGTAGAAATCGGTCAACCAGTACAACGTGGTGAAGTATTAACTGAAGGTTCTATTGAACCTAAGAATTACTTATCT
    GTTGCTGGATTAAACGCGACTGAAAGCTACTTATTAAAAGAAGTACAAAAAGTTTACCGTATGCAAGGGGTAGAAATCGA
    CGATAAACACGTTGAGGTTATGGTTCGACAAATGTTACGTAAAGTTAGAATTATCGAAGCAGGTGATACGAAGTTATTAC
    CAGGTTCATTAGTTGATATTCACAACTTTACAGATGCAAATAGAGAAGCATTTAAACACCGCAAGCGCCCTGCAACAGCT
    AAACCAGTATTACTTGGTATTACTAAAGCATCACTTGAAACAGAAAGTTTCTTATCTGCAGCATCATTCCAAGAAACAAC
    AAGAGTTCTAACAGATGCAGCAATTAAAGGTAAGCGTGATGACTTATTAGGTCTTAAAGAAAACGTAATTATCGGTAAGC
    TAATTCCAGCTGGTACTGGTATGAGACGTTATAGCGACGTAAAATACGAAAAAACAGCTAAACCAGTTGCAGAAGTTGAA
    TCTCAAACTGAAGTAACGGAATAA