MEGAResFrom MEG, the Microbial Ecology Group

RPOC

The rpoC gene encodes a subunit of the 30S rRNA polymerase. Mutations in this protein have been linked with resistance to daptomycin.

References

Sequences

Download Sequences

>CARD|pvgb|NC_002952|594518-598142|ARO:3003291|Staphylococcus|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoC|RPOC|RequiresSNPConfirmation
TTGATTGATGTAAATAATTTCCATTATATGAAAATAGGATTGGCTTCACCTGAAAAAATCCGTTCTTGGTCTTTTGGTGA
AGTTAAAAAACCTGAAACAATCAACTACCGTACATTAAAACCTGAAAAAGATGGTCTATTCTGTGAAAGAATTTTCGGAC
CTACAAAAGACTGGGAATGTAGTTGTGGTAAATACAAACGTGTTCGCTACAAAGGCATGGTCTGTGACAGATGTGGAGTT
GAAGTAACTAAATCTAAAGTACGTCGTGAAAGAATGGGTCACATTGAACTTGCTGCTCCAGTTTCTCACATTTGGTATTT
CAAAGGTATACCAAGTCGTATGGGATTATTACTTGACATGTCACCAAGAGCATTAGAAGAAGTTATTTACTTTGCTTCTT
ATGTTGTTGTAGATCCAGGTCCAACTGGTTTAGAAAAGAAAACTTTATTATCTGAAGCTGAATTCAGAGATTATTATGAT
AAATACCCAGGTCAATTCGTTGCAAAAATGGGTGCAGAAGGTATTAAAGATTTACTTGAAGAGATTGATCTTGACGAAGA
ACTTAAATTGTTACGCGATGAGTTGGAATCAGCTACTGGTCAAAGACTTACTCGTGCAATTAAACGTTTAGAAGTTGTTG
AATCATTCCGTAATTCAGGTAACAAACCTTCATGGATGATTTTAGATGTACTTCCAATCATCCCACCAGAAATTCGTCCA
ATGGTTCAATTAGATGGTGGACGATTTGCAACAAGTGACTTAAACGACTTATACCGTCGTGTAATTAATCGAAATAATCG
TTTGAAACGTTTATTAGATTTAGGTGCACCTGGTATCATCGTTCAAAACGAAAAACGTATGTTACAAGAAGCCGTTGACG
CTTTAATTGATAATGGTCGTCGTGGTCGTCCAGTTACTGGCCCAGGTAACCGTCCATTAAAATCTTTATCTCATATGTTA
AAAGGTAAACAAGGTCGTTTCCGTCAAAACCTACTTGGTAAACGTGTTGACTATTCAGGACGTTCAGTTATCGCGGTAGG
TCCAAGCTTGAAAATGTACCAATGTGGTTTACCGAAAGAAATGGCACTTGAACTATTTAAACCATTTGTAATGAAAGAAT
TAGTTCAACGTGAAATTGCAACTAACATTAAAAATGCGAAGAGTAAAATCGAACGCATGGATGATGAAGTTTGGGACGTA
TTGGAAGAAGTAATTAGAGAACATCCTGTATTACTTAACCGTGCACCAACACTTCATAGACTTGGTATTCAAGCATTTGA
ACCAACTTTAGTTGAAGGTCGTGCGATTCGTCTACATCCACTTGTAACAACAGCTTATAACGCTGACTTTGATGGTGACC
AAATGGCGGTTCACGTTCCTTTATCAAAAGAGGCACAAGCTGAAGCAAGAATGTTGATGTTAGCAGCACAAAACATCTTG
AACCCTAAAGATGGTAAACCAGTAGTTACACCATCACAAGATATGGTACTTGGTAACTATTACCTTACTTTAGAAAGAAA
AGATGCAGTAAATACAGGCGCAATCTTTAATAATACAAATGAAGTGTTAAAAGCATATGCAAATGGCTTTGTACATTTAC
ACACAAGAATTGGTGTACATGCAAGTTCATTCAACAACCCAACATTTACTGAAGAACAAAACAAAAAGATTCTTGCTACG
TCAGTAGGTAAAATTATATTCAATGAAATCATTCCGGATTCATTTGCTTATATTAATGAACCTACGCAAGAAAACTTAGA
AAGAAAGACACCAAACAGATACTTCATCGATCCTACAACTTTAGGTGAAGGTGGATTAAAAGAATACTTTGAAAATGAAG
AATTAATTGAACCTTTCAACAAAAAATTCTTAGGTAATATTATTGCAGAAGTATTCAACAGATTTAGCATCACTGATACA
TCAATGATGTTAGACCGTATGAAAGACTTAGGATTCAAATTCTCATCTAAAGCTGGTATTACAGTAGGTGTTGCTGATAT
CGTAGTATTACCTGATAAGCAACAAATACTTGATGAGCATGAAAAATTAGTCGACAGAATTACAAAACAATTCAATCGTG
GTTTAATCACTGAAGAAGAAAGATATAATGCAGTTGTTGAAATTTGGACAGATGCAAAAGATCAAATTCAAGGTGAATTG
ATGCAATCACTTGATAAAACTAACCCAATCTTCATGATGAGTGATTCAGGTGCCCGTGGTAACGCATCTAACTTTACACA
GTTAGCAGGTATGCGTGGATTGATGGCCGCACCATCTGGTAAGATTATCGAATTACCAATCACATCTTCATTCCGTGAAG
GTTTAACAGTACTTGAATACTTCATCTCAACTCACGGTGCGCGTAAAGGTCTTGCCGATACAGCACTTAAGACAGCTGAC
TCAGGATATCTTACTCGTCGTCTTGTTGACGTGGCACAAGATGTTATTGTTCGTGAAGAAGACTGTGGTACAGATAGAGG
TTTATTAGTTTCTGATATTAAAGAAGGTACAGAAATGATTGAACCATTTATCGAACGTATTGAAGGTCGTTATTCTAAAG
AAACAATTCGTCATCCTGAAACTGATGAAGTTATCATTCGTCCTGATGAATTAATTACACCTGAAATTGCTAAGAAAATT
ACAGATGCTGGTATTGAACAAATGTATATTCGCTCAGCATTTACTTGTAACGCAAGACACGGTGTTTGTGAAAAATGTTA
CGGTAAAAACCTTGCTACTGGTGAAAAAGTTGAAGTTGGTGAAGCAGTTGGTACAATTGCAGCCCAATCTATCGGTGAAC
CAGGTACACAGCTTACAATGCGTACATTCCATACAGGTGGGGTAGCAGGTAGCGATATCACACAAGGTCTTCCTCGTATT
CAAGAGATTTTCGAAGCACGTAACCCTAAAGGTCAAGCGGTAATTACGGAAATCGAAGGTGTCGTAGAAGATATTAAATT
AGCAAAAGATAGACAACAAGAAATTGTTGTTAAAGGTGCTAATGAAACAAGATCATATCTTGCTTCAGGTACTTCAAGAA
TTATTGTAGAAATCGGTCAACCAGTACAACGTGGTGAAGTATTAACTGAAGGTTCTATTGAACCTAAGAATTACTTATCT
GTTGCTGGATTAAACGCGACTGAAAGCTACTTATTAAAAGAAGTACAAAAAGTTTACCGTATGCAAGGGGTAGAAATCGA
CGATAAACACGTTGAGGTTATGGTTCGACAAATGTTACGTAAAGTTAGAATTATCGAAGCAGGTGATACGAAGTTATTAC
CAGGTTCATTAGTTGATATTCACAACTTTACAGATGCAAATAGAGAAGCATTTAAACACCGCAAGCGCCCTGCAACAGCT
AAACCAGTATTACTTGGTATTACTAAAGCATCACTTGAAACAGAAAGTTTCTTATCTGCAGCATCATTCCAAGAAACAAC
AAGAGTTCTAACAGATGCAGCAATTAAAGGTAAGCGTGATGACTTATTAGGTCTTAAAGAAAACGTAATTATCGGTAAGC
TAATTCCAGCTGGTACTGGTATGAGACGTTATAGCGACGTAAAATACGAAAAAACAGCTAAACCAGTTGCAGAAGTTGAA
TCTCAAACTGAAGTAACGGAATAAC