MEGAResFrom MEG, the Microbial Ecology Group

rpoB

The rpoB gene encodes the beta subunit of the 30S rRNA polymerase. Mutations in this protein have been linked with resistance to rifampin (primarily) and also lipopeptides and glycopeptides, though this second mechanism is less clearly described.

References

Sequences

Download Sequences

>CARD|pvgb|NC_002952|590830-594382|ARO:3003287|Staphylococcus|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoB|rpoB|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA