MEGAResFrom MEG, the Microbial Ecology Group

RPOBL

The RPOBL group of genes confer resistance to Lipopeptides through the mechanism, Daptomycin-resistant beta-subunit of RNA polymerase RpoB.

Sequences

Download Sequences

>MEG_6148|Drugs|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOBL|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA

>MEG_6149|Drugs|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOBL|RequiresSNPConfirmation
TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
CTCCTGAAACACAAAAAGAAGTTACTGATTAA