MEGAResFrom MEG, the Microbial Ecology Group

RPOBL

The RPOBL group of genes confer resistance to Lipopeptides through the mechanism, Daptomycin-resistant beta-subunit of RNA polymerase RpoB.

References

    Sequences

    Download Sequences

    >>MEG_6136|Drugs|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOBL|RequiresSNPConfirmation
    TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
    AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
    CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
    TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
    AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
    TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
    ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
    ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
    ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
    CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
    AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
    TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
    GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
    TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
    GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
    GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
    AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
    TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
    CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
    CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
    CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
    GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
    GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
    CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
    AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
    TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
    TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
    ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
    GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
    TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
    ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
    TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
    CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
    GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
    ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
    TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
    GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
    TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
    AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
    GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
    AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
    AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
    AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
    GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
    CTCCTGAAACACAAAAAGAAGTTACTGATTAA

    >>MEG_6137|Drugs|Lipopeptides|Daptomycin-resistant_beta-subunit_of_RNA_polymerase_RpoB|RPOBL|RequiresSNPConfirmation
    TTGGCAGGTCAAGTTGTCCAATATGGAAGACATCGTAAACGTAGAAACTACGCGAGAATTTCAGAAGTATTAGAATTACC
    AAACTTAATAGAAATTCAAACTAAATCTTACGAGTGGTTCCTAAGAGAAGGTTTAATCGAAATGTTTAGAGACATTTCTC
    CAATTGAAGATTTTACTGGTAATTTGTCATTAGAGTTTGTGGATTACCGTTTAGGAGAACCAAAATATGATTTAGAAGAA
    TCTAAAAACCGTGACGCTACTTATGCTGCACCTCTTCGTGTAAAAGTGCGTCTAATCATTAAAGAAACAGGAGAAGTTAA
    AGAACAAGAAGTCTTTATGGGTGATTTCCCATTAATGACTGATACAGGTACGTTCGTTATCAATGGTGCAGAACGTGTAA
    TCGTATCTCAATTAGTTCGTTCACCATCCGTTTATTTCAATGAAAAAATCGACAAAAATGGTCGTGAAAACTATGATGCA
    ACAATTATTCCAAACCGAGGTGCATGGTTAGAATATGAAACAGATGCTAAAGATGTTGTATACGTGCGTATTGATAGAAC
    ACGTAAACTACCATTAACAGTATTGTTACGTGCATTAGGTTTCTCAAGTGACCAAGAAATTGTTGACCTTTTAGGTGACA
    ATGAATATTTACGTAATACTTTAGAGAAAGACGGCACTGAAAACACTGAACAAGCGTTATTAGAAATCTATGAACGTTTA
    CGTCCAGGTGAACCACCAACTGTTGAAAATGCTAAAAGTCTATTGTATTCACGTTTCTTTGATCCAAAACGCTATGACTT
    AGCAAGCGTGGGTCGTTATAAAACAAACAAAAAATTACATTTAAAACATCGTTTATTCAATCAAAAATTAGCTGAGCCAA
    TTGTGAATACTGAAACTGGTGAAATTGTAGTTGAAGAAGGTACAGTGCTTGATCGTCGTAAAATCGACGAAATCATGGAT
    GTACTTGAATCAAACGCAAACAGCGAAGTGTTTGAATTGCATGGTAGCGTTATAGACGAGCCAGTAGAAATTCAATCAAT
    TAAAGTATATGTTCCTAACGATGATGAAGGTCGTACGACAACTGTAATTGGTAATGCTTTCCCTGACTCAGAAGTTAAAT
    GTATTACACCGGCAGATATCATCGCTTCAATGAGTTACTTCTTTAACTTATTAAGTGGTATTGGATATACAGATGATATT
    GACCATTTAGGTAACCGTCGTTTACGTTCTGTAGGTGAATTACTACAAAACCAATTCCGTATCGGTTTATCAAGAATGGA
    AAGAGTTGTACGTGAAAGAATGTCAATTCAAGATACTGAGTCTATCACACCTCAACAATTAATTAATATTCGACCTGTTA
    TTGCATCTATTAAAGAATTCTTTGGTAGCTCTCAATTATCACAATTCATGGACCAAGCAAATCCATTAGCTGAGTTAACG
    CATAAACGTCGTCTATCAGCATTAGGACCTGGTGGTTTAACACGTGAACGTGCTCAAATGGAAGTGCGTGACGTTCACTA
    CTCTCACTATGGCCGTATGTGTCCAATTGAAACGCCTGAGGGACCAAACATTGGATTGATTAACTCATTATCAAGTTATG
    CACGTGTAAATGAATTCGGCTTTATTGAAACACCATATCGTAAAGTTGATTTAGATACACATGCTATCACTGATCAAATT
    GACTATTTAACAGCTGACGAAGAAGATAGCTATGTTGTAGCACAAGCAAACTCTAAATTAGATGAAAATGGTCGTTTCAT
    GGATGATGAAGTTGTATGTCGTTTCCGTGGTAACAATACAGTTATGGCTAAAGAAAAAATGGATTATATGGATGTATCGC
    CGAAGCAAGTTGTTTCAGCAGCGACAGCATGTATTCCATTCTTAGAAAATGATGACTCAAACCGTGCATTGATGGGTGCG
    AACATGCAACGTCAAGCAGTGCCTTTGATGAATCCAGAAGCACCATTTGTTGGTACAGGTATGGAACACGTTGCAGCACG
    TGATTCTGGTGCAGCTATTACAGCTAAGCACAGAGGTCGTGTTGAACATGTTGAATCTAATGAAATTCTTGTACGTCGTC
    TAGTTGAAGAGAACGGCGTTGAGCATGAAGGTGAATTAGATCGCTATCCATTAGCTAAATTTAAACGTTCAAACTCAGGT
    ACATGTTACAACCAACGTCCAATCGTTGCAGTTGGAGATGTTGTTGAGTTTAACGAGATTTTAGCAGATGGACCATCTAT
    GGAATTAGGAGAAATGGCATTAGGTAGAAACGTAGTAGTTGGTTTCATGACTTGGGACGGTTACAACTATGAGGATGCCG
    TTATCATGAGTGAAAGACTTGTGAAAGATGACGTGTATACTTCTATTCATATTGAAGAGTATGAATCAGAAGCACGTGAT
    ACTAAGTTAGGACCTGAAGAAATCACAAGAGATATTCCTAATGTTTCTGAAAGTGCACTTAAGAACTTAGACGATCGTGG
    TATCGTTTATATTGGTGCAGAAGTAAAAGATGGAGATATTTTAGTTGGTAAAGTAACGCCTAAAGGTGTAACTGAGTTAA
    CTGCCGAAGAAAGATTGTTACATGCAATCTTTGGTGAAAAAGCACGTGAAGTTAGAGATACTTCATTACGTGTACCTCAC
    GGCGCTGGCGGTATCGTTCTTGATGTAAAAGTATTCAATCGTGAAGAAGGCGACGACACATTATCACCTGGTGTAAACCA
    ATTAGTACGTGTATATATCGTTCAAAAACGTAAAATTCATGTTGGTGATAAGATGTGTGGTCGACATGGTAACAAAGGTG
    TCATTTCTAAGATTGTTCCTGAAGAAGATATGCCTTACTTACCAGATGGACGTCCGATTGATATCATGTTAAATCCTCTT
    GGTGTACCATCTCGTATGAACATCGGACAAGTATTAGAGCTACACTTAGGTATGGCTGCTAAAAATCTTGGTATTCACGT
    TGCATCACCAGTATTTGACGGTGCAAACGATGACGATGTATGGTCAACAATTGAAGAAGCTGGTATGGCTCGTGATGGTA
    AAACTGTACTTTATGATGGACGTACAGGTGAACCATTCGATAACCGTATTTCAGTAGGTGTAATGTACATGTTGAAACTT
    GCGCACATGGTTGATGATAAATTACATGCGCGTTCAACAGGACCATATTCACTTGTTACACAACAACCACTTGGCGGTAA
    AGCGCAATTCGGTGGACAACGTTTCGGTGAGATGGAGGTATGGGCACTTGAAGCATATGGTGCTGCATACACATTACAAG
    AAATCTTAACTTACAAATCCGATGATACAGTAGGACGTGTGAAAACATACGAGGCTATTGTTAAAGGTGAAAACATCTCT
    AGACCAAGTGTTCCAGAATCATTCCGAGTATTGATGAAAGAATTACAAAGTTTAGGTTTAGATGTAAAAGTTATGGATGA
    GCAAGATAATGAAATCGAAATGACAGACGTTGATGACGATGATGTTGTAGAACGCAAAGTAGATTTACAACAAAATGATG
    CTCCTGAAACACAAAAAGAAGTTACTGATTAA