MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MCR

The MCR-1 gene encodes a phosphoethanolamine transferase that transfers phosphoethanolamine to Lipid A, preventing the mechanism of action of colistin.

References

  • http://www.thelancet.com/journals/laninf/article/PIIS1473-3099(15)00424-7/abstract

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Colistin phosphoethanolamine transferase

Sequences

Download Sequences

>>MEG_3666|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgacatcacatcactcttggtatcgctattctatcaatccctttgtgctgatgggtttggtggcgttatttttggcagc
gacagcgaacctgacattttttgaaaaagcgatggcggtctatcctgtatcggataacttaggctttatcatctcaatgg
cggtggcggtgatgggtgctatgctattgattgttgtgctattatcctatcgctatgtgctaaagcctgtgctgattttg
ctgcttatcatgggtgcggtgacgagctattttaccgatacttatggcacggtctatgacaccaccatgctccaaaatgc
catgcaaaccgaccaagccgagtctaaagacttgatgaatttggcgttttttgtgcggattatcgggcttggcgtgttgc
caagtctattggtcgcagttgccaaagtgggttatccaacatggggcaaaagcctgattcagcgtgcgatgacgtggggt
gtcagccttgtgttgttgcttgtgccgattgggttatttagcagtcagtatgcgagtttctttcgggtgcataagccagt
gcgtttttatatcaacccgattacgccgatttattcggtgggtaagcttgccagtatcgagtacaaaaaagccactgcac
caacagacaccatctatcatgccaaagatgccgtgcagaccaccaagcctagcgagcgtaagccccgtctagtggtgttc
gtcgtcggtgagacggcgcgtgctgaccatgtgcagttcaatggctatagccgtgagactttcccgcagcttgccaaagt
tgatggcttggcgaactttagccaagtgacatcgtgtggcacatcgacggcgtattctgtgccgtgtatgttcagctatt
tgggtcaagatgactatgatgtcgataccgccaaataccaagaaaatgtgctagatacgcttgaccgcttgggcgtgggt
atcttgtggcgtgataataattcagactcaaaaggcgtgatggataagctacctgctacgcagtattttgattataaatc
agcgaccaacaacaccatctgtaacaccaacccttataatgaatgtcgtgatgtcggtatgcttgttgggcttgatgact
atgtcagcgccaataatggcaaagatatgctcatcatgctacaccaaatgggcaatcatgggccggcgtactttaagcgt
tatgatgagcaatttaccaaattcacccctgtgtgcgaaggcaacgagcttgccaaatgcgaacatcaatcgctcatcaa
tgcctatgataatgcactgcttgccaccgatgattttatcgccaaaagtatcgattggctaaaaacacatgaagcaaact
acgatgtcgccatgctctatgtcagcgaccacggcgagagcttgggcgaaaatggtgtctatctgcatggtatgccaaat
gcctttgcaccaaaagaacaacgagccgtacctgtgtttttttggtcaaataatacgacattcaagccaactgccagcga
tactgcattgacccatgatgcgattacgccgacattgcttaagctgtttgatgtcacagctgataaggtcaaagaccgca
cggcatttatccagtaa

>>MEG_3667|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtgggaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3668|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaactttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3669|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatagcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3670|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccatcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3671|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgtcagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3672|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgctgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3673|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgatgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgac
cgcgaccgccaatcttaccttttttgataaggtcagccaaacctatcccatcgcggacaatctcggctttgtgctgacga
tcgctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttg
attttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctcca
aaatgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtg
tgctaccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttg
atcgtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataa
gccgctgcgtagctatgtcaatccgatcataccaatctactcggtgggtaagcttgccagtattgagtataaaaaagcca
gtgcgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtg
gtgttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgc
caagatcgatggcgtgaccaattttagcaatgtcacatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttca
gctatctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggc
gtaagtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgatta
taaatccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttag
atgactttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtatttt
aagcgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtcctt
gatcaatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagca
atgcctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatg
ccaaatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaat
ggcaaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtca
aagaccgcaccgcattcatccgctga

>>MEG_3674|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgcagcatacttctgtgtggtaccgacgctcggtcagtccgtttgttcttgtggcgagtgttgccgttttcttgaccgc
gaccgccaatcttaccttttttgataaaatcagccaaacctatcccatcgcggacaatctcggctttgtgctgacgatcg
ctgtcgtgctctttggcgcgatgctactgatcaccacgctgttatcatcgtatcgctatgtgctaaagcctgtgttgatt
ttgctattaatcatgggcgcggtgaccagttattttactgacacttatggcacggtctatgatacgaccatgctccaaaa
tgccctacagaccgaccaagccgagaccaaggatctattaaacgcagcgtttatcatgcgtatcattggtttgggtgtgc
taccaagtttgcttgtggcttttgttaaggtggattatccgacttggggcaagggtttgatgcgccgattgggcttgatc
gtggcaagtcttgcgctgattttactgcctgtggtggcgttcagcagtcattatgccagtttctttcgcgtgcataagcc
gctgcgtagctatgtcaatccgatcatgccaatctactcggtgggtaagcttgccagtattgagtataaaaaagccagtg
cgccaaaagataccatttatcacgccaaagacgcggtacaagcaaccaagcctgatatgcgtaagccacgcctagtggtg
ttcgtcgtcggtgagacggcacgcgccgatcatgtcagcttcaatggctatgagcgcgatactttcccacagcttgccaa
gatcgatggcgtgaccaattttagcaatgtcaaatcgtgcggcacatcgacggcgtattctgtgccgtgtatgttcagct
atctgggcgcggatgagtatgatgtcgataccgccaaataccaagaaaatgtgctggatacgctggatcgcttgggcgta
agtatcttgtggcgtgataataattcggactcaaaaggcgtgatggataagctgccaaaagcgcaatttgccgattataa
atccgcgaccaacaacgccatctgcaacaccaatccttataacgaatgccgcgatgtcggtatgctcgttggcttagatg
actttgtcgctgccaataacggcaaagatatgctgatcatgctgcaccaaatgggcaatcacgggcctgcgtattttaag
cgatatgatgaaaagtttgccaaattcacgccagtgtgtgaaggtaatgagcttgccaagtgcgaacatcagtccttgat
caatgcttatgacaatgccttgcttgccaccgatgatttcatcgctcaaagtatccagtggctgcagacgcacagcaatg
cctatgatgtctcaatgctgtatgtcagcgatcatggcgaaagtctgggtgagaacggtgtctatctacatggtatgcca
aatgcctttgcaccaaaagaacagcgcagtgtgcctgcatttttctggacggataagcaaactggcatcacgccaatggc
aaccgataccgtcctgacccatgacgcgatcacgccgacattattaaagctgtttgatgtcaccgcggacaaagtcaaag
accgcaccgcattcatccgctga

>>MEG_3675|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttacattttgaaaattaaaattgtgccatttatttttttgttggccttttatttcgcgttcatgttgaactggcc
tggtgtactccatttctatgatatcatctataagttggagggtttcaaacttgggtttgcaatttctcttccaattttat
tagttgcggcattgaaccttgtttttatcccattttcagttcgatatttagttaaaccctttttcgctcttctaatcttg
ctgagtactatcgtaagctacgccatgatgaagtatcgggttctgtttgatcaaaacatgattcagaacatttttgaaac
caatcgcaatgaggcgtttgcatatttaaactttccaatcctgggttgggttactattgtggggtttattcctgctattt
tacttttctttgttgaagttgaatatgaggataaatggcttaacggggttataactcgttccctatcgatgcttgcatcc
attatagtgattactgttattgcagcactatactatcaggactatgtttctgtaggacgcaataactcaaatctccagcg
tgaaattattccggccaatttcgttaatagtaccgttaaatatgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgttcctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaacccatttaccagtaactctggtggtgtgatctcctt
taatgatgttcgttcatgtgggactgcaaccgctgtatctgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgctagatgtattgcaaaaaacggggatttccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgatcgagttcctaacatagagatcaagccgaaggattacccaaagttctgtgataa
aaacacatgctatgacgaggttgtccttcaaaacctcgatagtgaaattgcccaaatgaaaggggataagctggttggct
tccacctgattggtagccatggcccaacttactacaagcgatatcctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatatcgaaaactgcacggatgaagagcttaccaacacctatgacaacaccatccgctacacggatttcgtgat
tgcagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcacggtgaat
cactgggagctatggggctttacctgcacggtacaccatacaaatttgcaccggatgatcagacccgcgtacctatgcag
gtgtggatgtcacctggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3676|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgtgccgctcatattttttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaattctttacaaattagaagactttaaatttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttagtaaagcctttttttgcacttcttatcgca
cttagcgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcattagcatatttaagcttgacaattataggatgggttactattgctggctttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggtttaaagggattctaactcgcgtcctatcgatgtttgcatcc
cttatagtgattgcggttattgcagcactatactatcaagattatgtttcagtggggcgcaacaattcaaacctccagcg
tgaaattgttccggccaattttgttaatagtaccgttaaatatgtttataatcgttattttgcagaaccaatcccattta
ctactttaggtgatgatgcaaaacgggatactaataaaagtaagcccacgttgatgttcctggtcgttggtgaaacggct
cgtggtaaaaatttctcgatgaatggctatgagaaagataccaacccatttaccagtaaatctggtggtgtgatctcctt
taatgatgttcgttcgtgtgggacagcaaccgctgtatctgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagtacctaacatcgagatcaaaccgaaggatcacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcacccctgattgtcca
cgcattgatatcgaaaactgcacggatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttagtgat
tgcagagatgattgccaaattgaaaaactacgaagataagtacaacaccgcgttgctctacgtctctgatcacggtgaat
cactgggagctatggggctttacctgcacggtacaccgtacaagtttgcaccggatgatcagacccgcgtacctatgcag
atctggatgtcaccaggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccacaaccaatcgcta
ttctcatgacaacatattttcttctgtcctggggatatgggatgtgaagacagctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3677|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgtgccgctcatattttttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaattctttacaaattagaagactttaaatttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttagtaaagcctttttttgcacttcttatcgca
cttagcgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcattagcatatttaagcttgacaattataggatgggttactattgctggctttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggtttaaagggattctaactcgcgtcctatcgatgtttgcatcc
cttatagtgattgcggttattgcagcactatactatcaagattatgtttcagtggggcgcaacaattcaaacctccagcg
tgaaattgttccggccaattttgttaatagtaccgttaaatatgtttataatcgttattttgcagaaccaatcccattta
ctactttaggtgatgatgcaaaacgggatactaataaaagtaagcccacgttgatgttcctggtcgttggtgaaacggct
cgtggtaaaaatttctcgatgaatggctatgagaaagataccaacccatttaccagtaaatctggtggtgtgatctcctt
taatgatgttcgttcgtgtgggacagcaaccgctgtatctgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagtacctaacatcgagatcaaaccgaaggatcacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcacccctgattgtcca
cgcattgatatcgaaaactgcacggatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttagtgat
tgcagagatgattgccaaattgaaaacctacgaagataagtacaacaccgcgttgctctacgtctctgatcacggtgaat
cactgggagctatggggctttacctgcacggtacaccgtacaagtttgcaccggatgatcagacccgcgtacctatgcag
atctggatgtcaccaggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccacaaccaatcgcta
ttctcatgacaacatattttcttctgtcctggggatatgggatgtgaagacagctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3678|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatattttttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttctattttcgatacggtatttagtaaagcctttttttgcacttctgatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggccttagcatatttaagcttaccaattataggatgggttactattgctggctttatccctgccattt
tacttttctttgttgaaattgaatatgagaaaaaatggttcaaagggattataactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagataccaacccattcacaagtaagtctggtggtgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcgacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgccggaataattga

>>MEG_3679|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattaagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3680|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaataatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcgacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcactcctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tgcagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctgcacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3681|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattataggatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcgacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggtttcatcacagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3682|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgaaaatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3683|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtacaactttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3684|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgatgatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3685|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgatgatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3686|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgatgatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttgtct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3687|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcgacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcactcctgactgtcca
agcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tgcagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctgcacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3688|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccgtttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattataggatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcaacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcactcctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tgcagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctgcacggtacaccgtacaagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggtttcatcaaagaaaaaggcatgaatatggaatgtttgcagaaaaatgccgcagccaatcgcta
ttctcatgacaacatattttcttctgtcctgggaatatgggatgtgaagacggctatctacgaacaagaattagatatct
ttaagcaatgtcggaataattga

>>MEG_3689|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttgtgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3690|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttctttttggcactgtattttgcatttgtgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatccgtcccctgcatgttctccaatatggggagaaaggagtttg
atgataatcgcgctcgcaatagcgagggcctgctagatgtgttgcaaaaaacggggatctccattttttggaaggagaac
gatggaggctgcaaaggcgtctgcgaccgagtacctaacatcgaaatcgaaccaaaggatcaccctaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagacctcgatagtgaaattgctcaaatgaaaggggataagctggttgtct
tccacctgataggtagccatggcccaacctactacaagcgctaccctgatgctcatcgtcagttcacccctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tggagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttacctacacggtacaccgtaccagtttgcaccggatgatcagacccgtgttcctatgcag
gtgtggatgtcacctggatttaccaaagagaaaggcgttgatatggcgtgtttgcagcagaaagccgctgatactcgtta
ctcacacgataatattttctcatctgtattgggtatctgggacgtcaaaacatcagtttacgaaaagggtctagatattt
tcagtcaatgtcgtaatgttcaataa

>>MEG_3691|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgccttcccttataaaaataaaaattgttccgcttatgttttttttggcactgtattttgcatttatgctgaactggcg
tggagttctccatttttacgaaatcctttacaaattagaagattttaagtttggtttcgccatttcattaccaatattgc
ttgttgcagcgcttaactttgtatttgttccattttcgatacggtatttaataaagcctttttttgcacttcttatcgca
cttagtgcaatcgttagttacacaatgatgaagtatagagtcttgtttgatcaaaacatgattcagaatatttttgaaac
caatcaaaatgaggcgttagcatatttaagcttaccaattatagtatgggttactattgctggttttatccctgccattt
tacttttctttgttgaaattgaatatgaggaaaaatggttcaaagggattctaactcgtgccctatcgatgtttgcatca
cttatagtgattgcggttattgcagcactatactatcaagattatgtgtcagtggggcgcaacaattcaaacctccagcg
tgagattgttccagccaatttcgttaatagtaccgttaaatacgtttacaatcgttatcttgctgaaccaatcccattta
caactttaggtgatgatgcaaaacgggatactaatcaaagtaagcccacgttgatgtttctggtcgttggtgaaaccgct
cgtggtaaaaatttctcgatgaatggctatgagaaagacaccaatccatttaccagtaaatctggtggcgtgatctcctt
taatgatgttcgttcgtgtgggactgcaaccgctgtatctgtcccctgcatgttttccaatatggggagaaaggagtttg
atgataatctcgctcgtaatagcgagggtttgttagatgtgttgcagaaaacgggggtctccattttttggaaggagaac
gatggcggctgcaaaggcgtctgcgaccgagttcctaacatcgagatcaaaccgaaggattacccaaagttctgcgataa
aaacacatgctatgacgaggttgtccttcaagagctcgacagtgaaattgctcaaatgaaaggggataagctggttggct
tccacctgataggtagccatggcccaacctactacaaacgctaccctgatgctcatcgtcagttcactcctgactgtcca
cgcagtgatattgaaaactgcacagatgaagagctcaccaacacctatgacaacaccatccgctacaccgatttcgtgat
tgcagagatgattgccaagttgaaaacctacgaagataagtacaacaccgcgttgctctacgtctccgatcatggtgaat
cactgggagcattagggctttaccctcagagatcccctcatttttag

>>MEG_3692|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgcggttgtctgcatttatcactttcttgaaaatgcgcccgcaagtgcgcactgaatttttgactctgttcatcagcct
tgtgttcaccctgctgtgcaatggcgtgttttggaatgcccttcttgctggacgcgactccctaacttctggaacatggc
taatgctcctttgcactgggttgctgatcaccgggctgcaatggttgttgctccttctggtggccacgcgctggagtgtc
aagccactactgattctgcttgctgtcatgacgcccgccgccgtttatttcatgcgcaactacggggtttatctcgacaa
ggccatgctgcggaatctgatggagacggacgtcagggaagccagtgagctgttgcaatggagaatgctgccctacttgt
tggttgcagccgtatccgtgtggtggattgcgagagtcagggttttacgaacgggctggaaacaagcggtaatgatgcgc
agcgcttgtctggctggcgctctcgccatgatttccatgggtctgtggccagtcatggatgtgctgatacccacgcttcg
tgaaaacaagccgcttcgctatttgatcactcctgcaaactacgtcatctcgggcattcgggttttgactgaacaggcgt
catcgtcagcagacgaagcaagggaagtcgttgcagccgatgcgcatcgagggcctcaagaacaaggccgccgtcctcgt
gctctcgtactggttgtcggggaaaccgtcagggcggctaattgggggttgagcggctatgaacgacaaaccacccctga
gttggccgcacgcgacgtgatcaatttttccgatgtcaccagttgcgggacggatacggctacatcccttccctgcatgt
tttccctcaatggtcggcgcgactacgacgaacgccagattcgtcggcgcgagtccgtgctgcacgttttaaaccgtagt
gacgtcaacattctctggcgcgataaccagtcgggctgtaaaggcgtctgtgatggactgccctttgaaaacctgtcttc
ggcaggccatcccacactgtgccatggcgagcgctgcctggatgaaattctgctcgaagggttggccgagaagataacaa
caagccgcagcgatatgctgatcgttctgcatatgctgggcaatcacggcccagcgtatttccagcgctatcccgcaagc
taccgacgctggtcgccaacctgcgacaccaccgatctgtccagctgttcgcatgaagccttggtgaacacctacgacaa
cgccgtgctttacaccgatcatgtgcttgcccgtaccattgacctgctgtccggcatccgctcacacgacacggcgctgc
tgtacgtttccgatcatggggaatcgctcggcgagaaaggcctgtatctccatggcataccttacgtcatcgcgccggat
gagcagatcaaggtgccgatgatctggtggcagtcgagtcaggtttatgccgaccaagcctgtatgcaaactcatgcctc
tcgggcaccggtaagtcacgatcacctgtttcacaccttgctcgggatgttcgacgtgaaaaccgctgcctacacgccag
agttggaccttctggcaacatgcagaaaaggacaaccacaatga

>>MEG_3693|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
atgttcaagtatcttttatctttcaaactgaacccggtacaacggacctgggctgcagcattttttttcactacaatcgg
caacatagcactttggcaaacactatggattaatgtagatgttcataatatacataatctacttttttttgtcagtctgc
caatatttcttttctgctttctaagtatcttacttacaccagtcatggttattccatatttatgcaggcctctacttgta
gttcttattctaatcagtgcctgctgtagttatttcatgatgaaatacaacatattaattgaccgcagcatggtgcaaaa
cttttttgagactaatcaggctgaattaacatcatacttatccgttccttttctttccactctatttctacttggcattg
taccagcaattatcctggcgttgccttcaacagacaataagcggggagcttttagaattgaattgtggtggttggcgcat
atttgcatagctgtagtcttattagccatggttaccatggtgttttataaggattacgcatctctcatacgaaacaatat
gcagattaaagaccaagctttaccttttaactttgtgcgtaatacgaatggttaccttaaaagaaaataccaggcatctt
caacaattctacaaagcgtgggggaggatgctgtacgtccaatatattcaaattctccaccgaaactggtggttgtcgtc
gtgggcgaaaccgccagagcacagaatttccagctgaatggctattcgcgggtaaccaacccctatctttccagacgaca
tgatgttatcagtttcaaaaatgtgtcgtcatgcggaacggctaccgcaatatcactaccctgcatgttctcgcgaatgt
cacgtaacgaatacaatgaagtccgtgccgcatcagaagaaaacttgctggatatccttaaacgtacaggtgttgaggtg
ctatggcgcaacaataacaatggtggttgtaagggaatctgcaagcgagtacccacagatgatatgccggcaatgaaagt
aattggggaatgtgttaacaaagatggtacatgctttgatgaggtgttattatatcaactctcatcccgaattaatgcaa
tgcagggtgatgcgcttattgttttacatcaaatgggcagtcatggaccaacatattttgaacgttatccgtctacaagt
aaagtctttagcccaacttgcgacagcaacctgatcgaaaaatgctcaaataaagaactggtcaatacatacgacaatac
gctagtttatactgatcgtatgctgagcaaaactattgaactgttgcaacgttattccgggatgcgtgacgttgctatga
tatatctttctgatcatggagaatcgctgggggaaagcggaatatatcttcatggcacaccatatattattgcccccaag
gaacaaacacacatcccgatgtttatgtggttttcgtcttcattcgcgcagcattccaaattaaatctagaatgcctgac
cggtaatgccgacaaacaatacagtcatgataatttttatcattcaatacttggtctcttcaacgtaaaaaccagtgtat
ataaaccggagttagatatgtttactctatgtcgacaatctgaccacacaccactgtcttccgcagttgtaagagagaaa
acagatgggaatggttag

>>MEG_3694|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
gtgatttctagatttaagacgttatcggttaaccaattcactttcatcactgcgttgttttatgttgccattttcaatct
accgctctttggtatagtgcgaaaaggaattgaaaaacaaccagaagttgatccccttttcatcgcatctatgccgctat
ttttaacatttgcgctgagttttttgttttcaatttttaccgtcaaatacctgctgaagcccttttttatcgtattgacg
ttactttcctcaagtgtattttttgcagcctatcaatacaatgtcgtgtttgactacggcatgatagaaaacacgtttca
aacacatcctgctgaagcattgatgtatgtaaatcttgcatcaattaccaatctactgctgactgggctattaccgtcat
atcttatttataaggccgatattcattatcagcccttttttaaggagttattgcataaattagcctttatgctgctaatg
ttcgttggcattgggatagtcgcctttttttactatcaagattatgctgcatttgttcgaaacaacagtgagttaaggcg
ttacattgtccctacctattttgtcagtagtgcatctaaatatctcaatgagcactatttgcagacgcccatggaatacc
aacaacttggcctagatgcgaagaatgccagtcgtaacccgaacactaaacctaacttattagtgtttgttgtgggtgaa
actgcgcgctcaatgagctatcaatattatggatataacaagccaaccaatgctcatacccaaaatcaggggctgattgc
gtttaacgatactagctcatgcggcacggccacggcggtgtctctaccctgtatgttttcacgaatggggcgggcagact
atgatcctcgccgtgctaatgctcaagacacagtgattgatgtgttaagtcatagtggtataaaagtacagtggtttgat
aatgattctggctgtaaaggtgtgtgtgatcaggttgaaaatctcacgatagatttgaagagtgatccgaagctgtgttc
tggccaatattgttttgaccaagtattgctcaacaaattagataaaattctggcagtagcaccaagtcaagatacagtaa
tttttttgcatatcattggtagtcatggaccaacttattatcttagatacccgccagagcatcgtaaatttataccggat
tgtccgcgcagtgatattcaaaattgcagtcaagaagaactgattaacacctacgacaacactattctatatacggattt
tattctcagtgaagtggtgaataaattaaaaggtaagcaggatatgttcgatactgcaatgctgtatctctctgaccatg
gtgagtctttgggtgaaaagggcatgtatttacatggtgcgccctatagtattgcaccgaaagaacaaactagcgtacca
atgctggcttgggtatctaatgactttagccaagataatcagttgaacatgacttgtgttgcacagcgagcagaacaggg
cggcttttcccacgacaatttgttcgacagtttgctaggacttatgaatgtaaaaaccaccgtctatcagagccaactcg
atatttttgcaccttgcaggtattag

>>MEG_3695|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGTATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCGCGCTCGCAATAGCGAGGGCCTGCTAGATGTGTTGCAAAAAACGGGGATCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAAATCGAACCAAAGGATCACCCTAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGTCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACCAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3696|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3697|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAGGTCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3698|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCTGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3699|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATAATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3700|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGTACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3701|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAATGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCACACCGCATTCATCCGCTGA

>>MEG_3702|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTACGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3703|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCGGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3704|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGCGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3705|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCGGTTGTCTGCATTTATCACTTTCTTGAAAATGCGCCCGCAAGTGCGCACTGAATTTTTGACTCTGTTCATCAGCCT
TGTGTTCACCCTGCTGTGCAATGGCGTGTTTTGGAATGCCCTTCTTGCTGGACGCGACTCCCTAACTTCTGGAACATGGC
TAATGCTCCTTTGCACTGGGTTGCTGATCACCGGGCTGCAATGGTTGTTGCTCCTTCTGGTGGCCACGCGCTGGAGTGTC
AAGCCACTACTGATTCTGCTTGCTGTCATGACGCCCGCCGCCGTTTATTTCATGCGCAACTACGGGGTTTATCTCGACAA
GGCCATGCTGCGGAATCTGATGGAGACGGACGTCAGGGAAGCCAGTGAGCTGTTGCAATGGAGAATGCTGCCCTACTTGT
TGGTTGCAGCCGTATCCGTGTGGTGGATTGCGAGAGTCAGGGTTTTACGAACGGGCTGGAAACAAGCGGTAATGATGCGC
AGCGCTTGTCTGGCTGGCGCTCTCGCCATGATTTCCATGGGTCTGTGGCCAGTCATGGATGTGCTGATACCCACGCTTCG
TGAAAACAAGCCGCTTCGCTATTTGATCACTCCTGCAAACTACGTCATCTCGGGCATTCGGGTTTTGACTGAACAGGCGT
CATCGTCAGCAGACGAAGCAAGGGAAGTCGTTGCAGCCGATGCGCATCGAGGGCCTCAAGAACAAGGCCGCCGTCCTCGT
GCTCTCGTACTGGTTGTCGGGGAAACCGTCAGGGCGGCTAATTGGGGGTTGAGCGGCTATGAACGACAAACCACCCCTGA
GTTGGCCGCACGCGACGTGATCAATTTTTCCGATGTCACCAGTTGCGGGACGGATACGGCTACATCCCTTCCCTGCATGT
TTTCCCTCAATGGTCGGCGCGACTACGACGAACGCCAGATTCGTCGGCGCGAGTCCGTGCTGCACGTTTTAAACCGTAGT
GACGTCAACATTCTCTGGCGCGATAACCAGTCGGGCTGTAAAGGCGTCTGTGATGGACTGCCCTTTGAAAACCTGTCTTC
GGCAGGCCATCCCACACTGTGCCATGGCGAGCGCTGCCTGGATGAAATTCTGCTCGAAGGGTTGGCCGAGAAGATAACAA
CAAGCCGCAGCGATATGCTGATCGTTCTGCATATGCTGGGCAATCACGGCCCAGCGTATTTCCAGCGCTATCCCGCAAGC
TACCGACGCTGGTCGCCAACCTGCGACACCACCGATCTGGCCAGCTGTTCGCATGAAGCCTTGGTGAACACCTACGACAA
CGCCGTGCTTTACACCGATCATGTGCTTGCCCGTACCATTGACCTGCTGTCCGGCATCCGCTCACACGACACGGCGCTGC
TGTACGTTTCCGATCATGGGGAATCGCTCGGCGAGAAAGGCCTGTATCTCCATGGCATACCTTACGTCATCGCGCCGGAT
GAGCAGATCAAGGTGCCGATGATCTGGTGGCAGTCGAGTCAGGTTTATGCCGACCAAGCCTGTATGCAAACTCATGCCTC
TCGGGCACCGGTAAGTCACGATCACCTGTTTCACACCTTGCTCGGGATGTTCGACGTGAAAACCGCTGCCTACACGCCAG
AGTTGGACCTTCTGGCAACATGCAGAAAAGGACAACCACAATGA

>>MEG_3706|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTT
GACCGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGA
CGATCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTG
TTGATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCT
CCAAAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGG
GTGTGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGC
TTGATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCA
TAAGCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAG
CCAGTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTA
GTGGTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCT
TGCCAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGT
TCAGCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTG
GGCGTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGA
TTATAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCT
TAGATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTAT
TTTAAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTC
CTTGATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACA
GCAATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGT
ATGCCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCC
AATGGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAG
TCAAAGACCGCACCGCATTCATCCGCTGA

>>MEG_3707|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGTATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCGCGCTCGCAATAGCGAGGGCCTGCTAGATGTGTTGCAAAAAACGGGGATCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAAATCGAACCAAAGGATCACCCTAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACCAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3708|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCACCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3709|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGACATCACATCACTCTTGGTATCGCTATTCTATCAATCCTTTTGTGCTGATGGGTTTGGTGGCGTTATTTTTGGCAGC
GACAGCGAACCTGACATTTTTTGAAAAAGCGATGGCGGTCTATCCTGTATCGGATAACTTAGGCTTTATCATCTCAATGG
CGGTGGCGGTGATGGGTGCTATGCTACTGATTGTCGTGCTGTTATCCTATCGCTATGTGCTAAAGCCTGTCCTGATTTTG
CTACTGATTATGGGTGCGGTGACGAGCTATTTTACCGATACTTATGGCACGGTCTATGACACCACCATGCTCCAAAATGC
CATGCAAACCGACCAAGCCGAGTCTAAGGACTTGATGAATTTGGCGTTTTTTGTGCGAATTATCGGGCTTGGCGTGTTGC
CAAGTGTGTTGGTCGCAGTTGCCAAAGTCAATTATCCAACATGGGGCAAAGGTCTGATTCAGCGTGCGATGACATGGGGT
GTCAGCCTTGTGCTGTTGCTTGTGCCGATTGGACTATTTAGCAGTCAGTATGCGAGTTTCTTTCGGGTGCATAAGCCAGT
GCGTTTTTATATCAACCCGATTACGCCGATTTATTCGGTGGGTAAGCTTGCCAGTATCGAGTACAAAAAAGCCACTGCGC
CAACAGACACCATCTATCATGCCAAAGACGCCGTGCAGACCACCAAGCCGAGCGAGCGTAAGCCACGCCTAGTGGTGTTC
GTCGTCGGTGAGACGGCGCGTGCTGACCATGTGCAGTTCAATGGCTATGGCCGTGAGACTTTCCCGCAGCTTGCCAAAGT
TGATGGCTTGGCGAATTTTAGCCAAGTGACATCGTGTGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCAGCTATT
TGGGTCAAGATGACTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTAGATACGCTTGACCGCTTGGGTGTGGGT
ATCTTGTGGCGTGATAATAATTCAGACTCAAAAGGCGTGATGGATAAGCTACCTGCCACGCAGTATTTTGATTATAAATC
AGCAACCAACAATACCATCTGTAACACCAATCCCTATAACGAATGCCGTGATGTCGGTATGCTTGTCGGGCTAGATGACT
ATGTCAGCGCCAATAATGGCAAAGATATGCTCATCATGCTACACCAAATGGGCAATCATGGGCCGGCGTACTTTAAGCGT
TATGATGAGCAATTTGCCAAATTCACCCCCGTGTGCGAAGGCAACGAGCTTGCCAAATGCGAACACCAATCACTCATCAA
TGCCTATGACAATGCGCTACTTGCGACTGATGATTTTATCGCCAAAAGCATCGATTGGCTAAAAACGCATGAAGCGAACT
ACGATGTCGCCATGCTCTATGTCAGTGACCACGGCGAGAGCTTGGGCGAAAATGGTGTCTATCTGCATGGTATGCCAAAT
GCCTTTGCACCAAAAGAACAGCGAGCTGTGCCTGCGTTTTTTTGGTCAAATAATACGACATTCAAGCCAACTGCCAGCGA
TACTGTGCTGACGCATGATGCGATTACGCCAACACTGCTTAAGCTGTTTGATGTCACAGCGGGCAAGGTCAAAGACCGCG
CGGCATTTATCCAGTAA

>>MEG_3710|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGGTGCAGCATACTTCTGTGTGGTACCGATGCTCGGTCAGTCCGTTTGTTCTTGTGGCAAGTGTTTCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACACTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACTAGTTATTTTACTGACACTTATGGCACGGTCTATGACACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TACTACCAAGTTTGCTTGTGGCTTTTGTCAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGGTGCGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTTTTTCGCGTGCATAA
GCCGCTGCGTTCGTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATACGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTTGATACGCTGGATCGTTTGGGC
GTGAGCATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCAACCAACAACACCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCTTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCACTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCGATGCTGTATGTCAGCGATCATGGCGAGAGTCTAGGTGAGAATGGTGTCTATCTACATGGTATG
CCTAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACAGATAAGCAAACTGGCATCACGCCGAT
GGCGACCGATACTGTCCTGACCCATGATGCGATCACACCAACATTATTAAAGCTGTTCGATGTTACCGCAGATAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3711|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGACATCACAGCACTCTTGGTATCGCTACTCCATCAATCCTTTTGTACTGATGGGTTTGGTGGCGTTATTTTTGGCGGC
AACAGCGAACCTGACATTTTTTGAAAAAGCGATGGCGGTCTATCCTGTATCGGATAACTTAGGCTTTATCATCTCAATGG
CGGTTGCACTGATGGGTGCTATGCTATTGATTGTCGTGCTATTATCCTATCGCTATGTGCTAAAGCCTGTGCTGATTTTA
TTACTTATCATGGGTGCGGTGACGAGCTATTTTACCGATACTTATGGCACGGTCTATGATACCACCATGCTCCAAAATGC
CATGCAAACCGACCAAGCTGAATCTAAAGACTTGATGAATTTGGCGTTTTTTGTGCGGATTATCGGGCTTGGCGTGTTGC
CAAGTGTGTTGGTCGCATTTGCCAAAGTCAATTATCCAACATGGGGCAAAGGCCTGATTCAGCGTGCGATGACGTGGGGT
GTCAGCCTTGTGCTGTTGCTTGTGCCGATTGGGCTATTTAGCAGTCAGTATGCGAGTTTCTTTCGGGTGCATAAGCCAGT
GCGTTTTTATATCAATCCGATTACGCCGATTTATTCGGTGGGCAAGCTTGCCAGTATCGAGTACAAAAAAGCCACTGCAC
CAACAGACACCATCTATCATGCCAAAGATGCCGTGCAGACCACCAAGCCTAGCGAGCGTAAGCCACGCCTAGTAGTGTTC
GTCGTCGGTGAGACGGCGCGTGCTGACCATGTGCAGTTCAATGGCTATGGCCGTGAGACTTTCCCACAGCTTGCCAAAGT
TGATGGCTTGGCGAATTTTAGCCAAGTGACATCGTGTGGCACATCGACAGCGTATTCTGTGCCGTGTATGTTTAGCTATT
TGGGTCAAGATGACTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTAGATACGCTTGACCGCTTGGGCGTGGAT
ATCTTGTGGCGTGATAATAATTCAGACTCAAAAGGCGTGATGGATAAGCTACCTACCACGCAGTATTTTGATTATAAATC
AGCGACCAACAACACCATCTGTAACACCAATCCCTTTAATGAATGCCGTGATGTCGGTATGCTTGTTGGGCTAGATGACT
ATGTCAGTGCCAATAATGGCAAAGATATGCTCATCATGCTACACCAAATGGGCAATCATGGGCCGGCGTACTTTAAGCGT
TATGATGAGCAATTTGCCAAATTCACCCCTGTGTGCGAAGGCAATGAGCTTGCCAAATGCGAACACCAATCACTCATCAA
TGCCTATGATAATGCACTACTTGCCACCGATGATTTTATCGCCAAAAGTATCGATTGGCTAAAAACACATGAAGCAAACT
ACGATGTCGCTATGCTCTATGTCAGCGACCACGGCGAGAGCTTGGGCGAGAATGGTGTCTATCTGCATGGTATGCCAAAT
GCCTTTGCACCAAAAGAACAGCGAGCCGTGCCTGCGTTTTTTTGGTCAAATAATACGACATTCAAGCCAACTGCCAGCGA
CACTGTGCTGACGCATGATGCGATTACCCCGACATTGCTTAAGCTGTTTGATGTCACAGCCGACAAGGTCAAAGACCGCA
CGGCATTTATCCAGTAA

>>MEG_3712|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGACACAGCATAGTCCTTGGTACCGCCGTCCGGTCAATCCCTATCTGTTGATGAGCGTGGTCGCTTTATTTTTGTCAGC
GACAGCAAACCTAACTTTCTTTGATAAAATCACCAATACTTATCCGATGGCACAAAACGCAGGCTTTGTGATCTCAACGG
CGCTTGTGCTATTTGGGGCGATGCTATTGATTACTGTGCTGTTATCGTATCGCTATGTGCTTAAGCCTGTGTTGATTTTG
CTGCTTATCATGGGTGCGGTGACGAGCTATTTTACCGATACTTATGGCACCGTTTATGACACCACCATGCTCCAAAATGC
CTTGCAAACTGACCAAGCCGAGTCTAAGGACTTGATGAATATGGCGTTTTTTGTGCGGATTATCGGGCTTGGCGTGTTGC
CAAGTATCTTGGTGGCGTGGGTCAAGGTGGATTATCCGACATTGGGTAAGAGTCTGATTCAGCGTGCGATGACTTGGGGT
GTGGCAGTGGTGATGGCACTTGTGCCGATTTTGGCATTTAGTAGTCACTACGCCAGTTTCTTTCGTGAACATAAGCCACT
GCGTAGCTATGTCAATCCCGTGATGCCGATTTATTCAGTAGGTAAGCTTGCCAGTATTGAGTACAAAAAAGCCACCGCGC
CAAAAGACACCATCTATCATGCCAAAGATGCTGTACAGACGACGACGCCTGCCGAGCGTAAGCCACGACTCGTGGTGTTC
GTCGTCGGTGAGACGGCTCGAGCTGACCATGTGCAGTTTAATGGCTATAGTCGTGAGACTTTTCCGCAGCTTGCCAAGAT
TGACAACCTAGCCAATTTTAGCCAAGTGACATCGTGTGGCACATCGACGGCGTACTCTGTGCCGTGTATGTTCAGTTATC
TGGGTCAAGATGACTATGATGTCGATACCGCCAAATACCAAGAAAACGTGCTGGATACGCTTGACCGACTGGGTGTGGGT
ATCCTGTGGCGGGATAATAATTCAGACTCAAAAGGCGTGATGGATAAACTGCCTGCTTCGCAGTATTTTGATTATAAATC
AGCGACCAACAACACCATCTGTAACACCAATCCTTACAACGAATGTCGTGATGTCGGTATGTTGGTGGGGCTAGATGATT
ATGTGAGTACCAATCAAGGCAAAGATATGCTCATCATGCTACACCAAATGGGTAATCATGGGCCGGCGTACTTCAAGCGT
TATGACGAGCAATTTGCCAAATACACCCCTGTGTGCGAAGGTAATGAACTTGCCAAGTGTGAACACCAATCGCTCATCAA
CGCCTATGATAATGCACTGCTTGCGACCGATGATTTTATCGCCAAAAGTATCGATTGGCTAAAAACGCATCAGGCCAACT
ATGATGTTGCCATGCTCTATGTCAGCGACCACGGCGAGAGTCTGGGTGAAAATGGCGTCTATCTGCATGGTATGCCAAAT
GCCTTTGCACCAAAAGAACAGCGAGCGGTACCGGCATTCTTTTGGTCAAATAATCCATCGTTCACGCCAACTGCCAGCGA
CACTGTGCTGACACATGATGCGATTACGCCGACTCTACTGAAGCTGTTTGATGTCACAGCGGATAAGGTCAAAGACCGCA
CCGCATTCATCCGCTGA

>>MEG_3713|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTGTGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGTATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCGCGCTCGCAATAGCGAGGGCCTGCTAGATGTGTTGCAAAAAACGGGGATCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAAATCGAACCAAAGGATCACCCTAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGAATTAGGGCTTTACCTACACGGTACACCGTACCAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTATCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3714|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGGATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCTGTCCCCTGCATGTTTTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTTCCTAACATCGAGATCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGAGCTCGACAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAACGCTACCCTGATGCTCATCGTCAGTTCACTCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGCAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTGCACGGTACACCGTACAAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGTTTCATCAAAGAAAAAGGCATGAATATGGAATGTTTGCAGAAAAATGCCGCAGCCAATCGCTA
TTCTCATGACAACATATTTTCTTCTGTCCTGGGAATATGGGATGTGAAGACGGCTATCTACGAACAAGAATTAGATATCT
TTAAGCAATGTCGGAATAATTGA

>>MEG_3715|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
GTGATTTCTAGATTTAAGACGTTATCGGTTAACCAATTCACTTTCATCACTGCGTTGTTTTATGTTGCCATTTTCAATCT
ACCGCTCTTTGGTATAGTGCGAAAAGGAATTGAAAAACAACCAGAAGTTGATCCCCTTTTCATCGCATCTATGCCGCTAT
TTTTAACATTTGCGCTGAGTTTTTTGTTTTCAATTTTTACCGTCAAATACCTGCTGAAGCCCTTTTTTATCGTATTGACG
TTACTTTCCTCAAGTGTATTTTTTGCAGCCTATCAATACAATGTCGTGTTTGACTACGGCATGATAGAAAACACGTTTCA
AACACATCCTGCTGAAGCATTGATGTATGTAAATCTTGCATCAATTACCAATCTACTGCTGACTGGGCTATTACCGTCAT
ATCTTATTTATAAGGCCGATATTCATTATCAGCCCTTTTTTAAGGAGTTATTGCATAAATTAGCCTTTATGCTGCTAATG
TTCGTTGGCATTGGGATAGTCGCCTTTTTTTACTATCAAGATTATGCTGCATTTGTTCGAAACAACAGTGAGTTAAGGCG
TTACATTGTCCCTACCTATTTTGTCAGTAGTGCATCTAAATATCTCAATGAGCACTATTTGCAGACGCCCATGGAATACC
AACAACTTGGCCTAGATGCGAAGAATGCCAGTCGTAACCCGAACACTAAACCTAACTTATTAGTGGTTGTTGTGGGTGAA
ACTGCGCGCTCAATGAGCTATCAATATTATGGATATAACAAGCCAACCAATGCTCATACCCAAAATCAGGGGCTGATTGC
GTTTAACGATACTAGCTCATGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACGAATGGGGCGGGCAGACT
ATGATCCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGAT
AATGATTCTGGCTGTAAAGGTGTGTGTGATCAGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTC
TGGCCAATATTGTTTTGACCAAGTATTGCTCAACAAATTAGATAAAATTCTGGCAGTAGCACCAAGTCAAGATACAGTAA
TTTTTTTGCATATCATTGGTAGTCATGGACCAACTTATTATCTTAGATACCCGCCAGAGCATCGTAAATTTATACCGGAT
TGTCCGCGCAGTGATATTCAAAATTGCAGTCAAGAAGAACTGATTAACACCTACGACAACACTATTCTATATACGGATTT
TATTCTCAGTGAAGTGGTGAATAAATTAAAAGGTAAGCAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCATG
GTGAGTCTTTGGGTGAAAAGGGCATGTATTTACATGGTGCGCCCTATAGTATTGCACCGAAAGAACAAACTAGCGTACCA
ATGCTGGCTTGGGTATCTAATGACTTTAGCCAAGATAATCAGTTGAACATGACTTGTGTTGCACAGCGAGCAGAACAGGG
CGGCTTTTCCCACGACAATTTGTTCGACAGTTTGCTAGGACTTATGAATGTAAAAACCACCGTCTATCAGAGCCAACTCG
ATATTTTTGCACCTTGCAGGTATTAG

>>MEG_3716|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATTAAAATTGTGCCGCTCATATTTTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAATATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAGTAAAGCCTTTTTTTGCACTTCTGATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTATTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAACTTACCAATTATAGGATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGATATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCTGCACTATACTATCAAGATTATGTTTCAGTTGGGCGTAACAATTCAAACCTCCAGCG
TGAAATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATATGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTCCTGGTCGTTGGTGAAACCGCT
CGCGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCTGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTTCCTAACATCGAGATCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGACAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAACGCTACCCTGATGCTCATCGTCAGTTCACTCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACGGATTTCGTGAT
TGCAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCACGGTGAAT
CACTGGGAGCTATGGGGCTTTACCTGCACGGTACACCATACAAATTTGCACCGGATGATCAGACCCGCGTACCTATGCAG
GTGTGGATGTCACCTGGTTTCATCAAAGAAAAAGGCATGAATATGGAATGTTTGCAGAAAAATGCCGCAGCCAATCGCTA
TTCTCATGACAACATATTTTCTTCTGTCCTGGGAATATGGGATGTGAAGACGGCTATCTACGAACAAGAATTAGATATCT
TTAAGCAATGTCGGAATAATTGA

>>MEG_3717|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTGCCGCTCATATTTTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATTCTTTATAAATTAGAAGATTTTAAATTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAATTTTGCATTTGTTCCATTTTCGATACGGTATTTAGTAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGCGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCATTAGCATATTTAAGTTTGCCAATTATAGGATGGGTTACTATTGTTGGATTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTTAAAGGGATTCTAACTCGCGTCCTATCGATGTTTGCATCC
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTTTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAAATTGTTCCGGCCAATTTTGTTAATAGTACCGTTAAATATGTTTATAATCGTTATCTTGCAGAACCAATCCCATTTA
CTACTTTAGGTGATGATGCAAAACGGGATACTAATAAAAGTAAGCCCACGTTGATGTTCCTGGTCGTTGGTGAAACTGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGATACCAACCCATTTACCAGTAAATCTGGTGGTGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACAGCAACCGCTGTATCTGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAGGTCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAATACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTATCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACGGATTTCGTGAT
TGCAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCTATGGGGCTTTACCTGCACGGTACACCGTACAAGTTTGCACCGGATGATCAGACCCGCGTACCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCATGAATATGGAATGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3718|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATATTTTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTGATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATCATAGGATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGAAACAATTCAAACCTCCAGCG
TGAAATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCTGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTTCCTAACATCGAGATCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGAGCTCGACAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTCATAGGTAGCCATGGCCCAACCTACTACAAACGCTACCCTGATGCTCATCGTCAGTTCACTCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGCAGAGATGATTGCCAAGTTGAAAACCTACGAAGACAAGTACAACACCGCGTTGCTCTACGTCTCCGATCACGGTGAAT
CACTGGGAGCTATGGGGCTTTACCTGCACGGTACACCGTACAAATTTGCACCGGATGATCAGACCCGCGTACCTATGCAG
GTGTGGATGTCGCCTGGTTTCATCAAAGAAAAAGGCATGAATATGGAATGTTTGCAGAAAAATGCCGCAGCCAATCGCTA
TTCTCATGACAACATATTTTCTTCTGTCCTGGGAATATGGGATGTGAAGACGGCTATCTACGAACAAGAATTAGATATCT
TTAAGCAATGTCGGAATAATTGA

>>MEG_3719|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATATTTTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAGTAAAGCCTTTTTTTGCACTTCTGATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCCTTAGCATATTTAAGCTTACCAATTATAGGATGGGTTACTATTGCTGGCTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGAAAAAATGGTTCAAAGGGATTATAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGATACCAACCCATTCACAAGTAAGTCTGGTGGTGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCTGTCCCCTGCATGTTTTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTTCCTAACATCGAGATCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGAGCTCGACAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACAAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3720|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
GTGATTTCTAGATTTAAGACGTTATCGGTTAACCAATTCACTTTCATCACTGCGTTGTTTTATGTTGCCATTTTCAATCT
ACCGCTCTTTGGTATAGTGCGAAAAGGAATTGAAAAACAACCAGAAGTTGATCCCCTTTTCATCGCATCTATGCCGCTAT
TTTTAACATTTGCGCTGAGTTTTTTGTTTTCAATTTTTACCGTCAAATACCTGCTGAAGCCCTTTTTTATCGTATTGACG
TTACTTTCCTCAAGTGTATTTTTTGCAGCCTATCAATACAATGTCGTGTTTGACTACGGCATGATAGAAAACACGTTTCA
AACACATCCTGCTGAAGCATTGATGTATGTAAATCTTGCATCAATTACCAATCTACTGCTGACTGGGCTATTACCGTCAT
ATCTTATTTATAAGGCCGATATTCATTATCAGCCCTTTTTTAAGGAGTTATTGCATAAATTAGCCTTTATGCTGCTAATG
TTCGTTGGCATTGGGATAGTCGCCTTTTTTTACTATCAAGATTATGCTGCATTTGGTCGAAACAACAGTGAGTTAAGGCG
TTACATTGTCCCTACCTATTTTGTCAGTAGTGCATCTAAATATCTCAATGAGCACTATTTGCAGACGCCCATGGAATACC
AACAACTTGGCCTAGATGCGAAGAATGCCAGTCGTAACCCGAACACTAAACCTAACTTATTAGTGTTTGTTGTGGGTGAA
ACTGCGCGCTCAATGAGCTATCAATATTATGGATATAACAAGCCAACCAATGCTCATACCCAAAATCAGGGGCTGATTGC
GTTTAACGATACTAGCTCATGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACGAATGGGGCGGGCAGACT
ATGATCCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGAT
AATGATTCTGGCTGTAAAGGTGTGTGTGATCAGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTC
TGGCCAATATTGTTTTGACCAAGTATTGCTCAACAAATTAGATAAAATTCTGGCAGTAGCACCAAGTCAAGATACAGTAA
TTTTTTTGCATATCATTGGTAGTCATGGACCAACTTATTATCTTAGATACCCGCCAGAGCATCGTAAATTTATACCGGAT
TGTCCGCGCAGTGATATTCAAAATTGCAGTCAAGAAGAACTGATTAACACCTACGACAACACTATTCTATATACGGATTT
TATTCTCAGTGAAGTGGTGAATAAATTAAAAGGTAAGCAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCATG
GTGAGTCTTTGGGTGAAAAGGGCATGTATTTACATGGTGCGCCCTATAGTATTGCACCGAAAGAACAAACTAGCGTACCA
ATGCTGGCTTGGGTATCTAATGACTTTAGCCAAGATAATCAGTTGAACATGACTTGTGTTGCACAGCGAGCAGAACAGGG
CGGCTTTTCCCACGACAATTTGTTCGACAGTTTGCTAGGACTTATGAATGTAAAAACCACCGTCTATCAGAGCCAACTCG
ATATTTTTGCACCTTGCAGGTATTAG

>>MEG_3721|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGGATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCTGTCCCCTGCATGTTTTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTTCCTAACATCGAGATCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGAGCTCGACAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACAAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3722|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCGCATCACGCTCGGTGTGATGAAGGTGAATTTGTTGCTGGTGCTCTTTTTCGCACTGGTGCTGAACTGGCCTTTCTT
TCTTCGTTTTTATTCTGTTATCAGTGGTCTGGAACATGTCCGGGCCGGTTTCGTTATCTCGGTTCCTCTGGTGCTGCTTG
CCGCACTCAACGCCGTCTTTATCCCCTTTACCTTCCGCTGGTTGCTCAAGCCCTTCTTTTCGTTGTTGATCCTGACAGGC
TCCATCGTCAGTTACGCCATGCTCAAATACGGCGTCATCTTCGATGCCAGCATGATCCAGAACATAGTGGAGACCAACAA
CAGTGAGGCGACCTCCTACCTGAATGTGCCGGTCGTGCTCTGGTTCCTGCTGACCGGTGTGTTGCCCATGGTGGTGCTCT
GGTCGCTGAAGGTGCGCTATCCGGCAAACTGGTACAAGGGGCTGGCCATCAGGGCTGGTGCTCTGGCCTTCTCGCTGCTG
TTCGTGGGAGGCGTTGCCGCACTTTACTATCAGGATTACGTCTCGATCGGCCGCAATCACCGGATCCTGGGCAAGCAGAT
AGTGCCGGCCAACTATGTCAACGGCATCTACAAATATGCCCGCGACGTGGTATTTGCTACCCCCATCCCTTATCAACCGC
TGGGGACTGATGCCAAAGTCGTCGCCAAAGGGGATAAACCGACCCTGATGTTTCTGGTGGTGGGGGAGACAGCCCGCGGC
AAGAACTTCTCGATGAACGGCTACGAGAAAGAGACCAACCCCTTTACCAGTCAGGCCGGGGGCGTGATCTCCTTCAAGGA
CGTGCGCTCTTGCGGCACGGCCACAGCGGTGTCGGTGCCCTGCATGTTCTCCAACATGGGGCGCAAGGAGTTTGATGACA
ACCGGGCCCGCAACAGCGAAGGCCTGCTCGATGTGCTGCAAAGAAGCGGGGTCTCCATCTTCTGGAAGGAGAACGACGGC
GGCTGCAAAGGGGTGTGCGATCGGGTGCCCAACATCGAGATCAAGCCAAAAGATCACCCACAGTTCTGCGACAAGAACAC
CTGCTATGACGAGGTTGTACTGCAAAATCTCGACGACGAGGTGGCGCAGATGAAGGGCGACAAGCTGGTCGGTTTCCATC
TGATCGGCAGCCACCGCCCGCCCTACCACCAACGCTATCCGGACAAACCACCCCCGTTCGTACCGGACTGCCCGCGCAGC
GACATCGAGAACTGCAGCGATGAAGAGCTGGTCAACACCTATGACAACACCATCCGCTACACCGATTTTGTCATAGCAGA
GATGATTACCAAGCTGAAAAAGTATGAAGATAAGTACAACACGGCGTTGATCTACCTCTCTGATCACGGCGAGTCGCTGG
GTGCGATGGGGCTCTATCTGCATGGCACGCCCTACAAGTTTGCCCCTGACGACCAGACCCGGGTACCGATGCAGGTCTGG
ATGTCGCCGGGCTTTGCCAAAGAGAAGGGGATGGATCTGAACTGCCTGCAGCAAAAAGCGGCAGACAATCGCTACTCCCA
TGACAACCTCTTCTCCTCTGTGCTCGGGATCTGGGATGTCAGCACGGCGGTGTACGACAAGCAGCTCGATATTTTCAGCC
AGTGCCGCACCGTGCAGTAA

>>MEG_3723|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGATGCAGCATACTTCTGTGTGGTACCGACGCTCGGTCAGTCCGTTTGTTCTTGTGGCGAGTGTTGCCGTTTTCTTGAC
CGCGACCGCCAATCTTACCTTTTTTGATAAAATCAGCCAAACCTATCCCATCGCGGACAATCTCGGCTTTGTGCTGACGA
TCGCTGTCGTGCTCTTTGGCGCGATGCTACTGATCACCACGCTGTTATCATCGTATCGCTATGTGCTAAAGCCTGTGTTG
ATTTTGCTATTAATCATGGGCGCGGTGACCAGTTATTTTACTGACACTTATGGCACGGTCTATGATACGACCATGCTCCA
AAATGCCCTACAGACCGACCAAGCCGAGACCAAGGATCTATTAAACGCAGCGTTTATCATGCGTATCATTGGTTTGGGTG
TGCTACCAAGTTTGCTTGTGGCTTTTGTTAAGGTGGATTATCCGACTTGGGGCAAGGGTTTGATACGCCGATTGGGCTTG
ATCGTGGCAAGTCTTGCGCTGATTTTACTGCCTGTGGTGGCGTTCAGCAGTCATTATGCCAGTTTCTTTCGCGTGCATAA
GCCGCTGCGTAGCTATGTCAATCCGATCATGCCAATCTACTCGGTGGGTAAGCTTGCCAGTATTGAGTATAAAAAAGCCA
GTGCGCCAAAAGATACCATTTATCACGCCAAAGACGCGGTACAAGCAACCAAGCCTGATATGCGTAAGCCACGCCTAGTG
GTGTTCGTCGTCGGTGAGACGGCACGCGCCGATCATGTCAGCTTCAATGGCTATGAGCGCGATACTTTCCCACAGCTTGC
CAAGATCGATGGCGTGACCAATTTTAGCAATGTCACATCGTGCGGCACATCGACGGCGTATTCTGTGCCGTGTATGTTCA
GCTATCTGGGCGCGGATGAGTATGATGTCGATACCGCCAAATACCAAGAAAATGTGCTGGATACGCTGGATCGCTTGGGC
GTAAGTATCTTGTGGCGTGATAATAATTCGGACTCAAAAGGCGTGATGGATAAGCTGCCAAAAGCGCAATTTGCCGATTA
TAAATCCGCGACCAACAACGCCATCTGCAACACCAATCCTTATAACGAATGCCGCGATGTCGGTATGCTCGTTGGCTTAG
ATGACTTTGTCGCTGCCAATAACGGCAAAGATATGCTGATCATGCTGCACCAAATGGGCAATCACGGGCCTGCGTATTTT
AAGCGATATGATGAAAAGTTTGCCAAATTCACGCCAGTGTGTGAAGGTAATGAGCTTGCCAAGTGCGAACATCAGTCCTT
GATCAATGCTTATGACAATGCCTTGCTTGCCACCGATGATTTCATCGCTCAAAGTATCCAGTGGCTGCAGACGCACAGCA
ATGCCTATGATGTCTCAATGCTGTATGTCAGCGATCATGGCGAAAGTCTGGGTGAGAACGGTGTCTATCTACATGGTATG
CCAAATGCCTTTGCACCAAAAGAACAGCGCAGTGTGCCTGCATTTTTCTGGACGGATAAGCAAACTGGCATCACGCCAAT
GGCAACCGATACCGTCCTGACCCATGACGCGATCACGCCGACATTATTAAAGCTGTTTGATGTCACCGCGGACAAAGTCA
AAGACCGCACCGCATTCATCCGCTGA

>>MEG_3724|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCGGTTGTCTGCATTTATCACTTTCTTGAAAATGCGCCCGCAAGTGCGCACTGAATTTTTGACTCTGTTCATCAGCCT
TGTGTTCACCCTGCTGTGCAATGGCGTGTTTTGGAATGCCCTTCTTGCTGGACGCGACTCCCTAACTTCTGGAACATGGC
TAATGCTCCTTTGCACTGGGTTGCTGATCACCGGGCTGCAATGGTTGTTGCTCCTTCTGGTGGCCACGCGCTGGAGTGTC
AAGCCACTACTGATTCTGCTTGCTGTCATGACGCCCGCCGCCGTTTATTTCATGCGCAACTACGGGGTTTATCTCGACAA
GGCCATGCTGCGGAATCTGATGGAGACGGACGTCAGGGAAGCCAGTGAGCTGTTGCAATGGAGAATGCTGCCCTACTTGT
TGGTTGCAGCCGTATCCGTGTGGTGGATTGCGAGAGTCAGGGTTTTACGAACGGGCTGGAAACAAGCGGTAATGATGCGC
AGCGCTTGTCTGGCTGGCGCTCTCGCCATGATTTCCATGGGTCTGTGGCCAGTCATGGATGTGCTGATACCCACGCTTCG
TGAAAACAAGCCGCTTCGCTATTTGATCACTCCTGCAAACTACGTCATCTCGGGCATTCGGGTTTTGACTGAACAGGCGT
CATCGTCAGCAGACGAAGCAAGGGAAGTCGTTGCAGCCGATGCGCATCGAGGGCCTCAACAAGGCCGCCGTCCTCGTGCT
CTCGTACTGGTTGTCGGGGAAACCGTCAGGGCGGCTAATTGGGGGTTGAGCGGCTATGAACGACAAACCACCCCTGAGTT
GGCCGCACGCGACGTGATCAATTTTTCCGATGTCACCAGTTGCGGGACGGATACGGCTACATCCCTTCCCTGCATGTTTT
CCCTCAATGGTCGGCGCGACTACGACGAACGCCAGATTCGTCGGCGCGAGTCCGTGCTGCACGTTTTAAACCGTAGTGAC
GTCAACATTCTCTGGCGCGATAACCAGTCGGGCTGTAAAGGCGTCTGTGATGGACTGCCCTTTGAAAACCTGTCTTCGGC
AGGCCATCCCACACTGTGCCATGGCGAGCGCTGCCTGGATGAAATTCTGCTCGAAGGGTTGGCCGAGAAGATAACAACAA
GCCGCAGCGATATGCTGATCGTTCTGCATATGCTGGGCAATCACGGCCCAGCGTATTTCCAGCGCTATCCCGCAAGCTAC
CGACGCTGGTCGCCAACCTGCGACACCACCGATCTGGCCAGCTGTTCGCATGAAGCCTTGGTGAACACCTACGACAACGC
CGTGCTTTACACCGATCATGTGCTTGCCCGTACCATTGACCTGCTGTCCGGCATCCGCTCACACGACACGGCGCTGCTGT
ACGTTTCCGATCATGGGGAATCGCTCGGCGAGAAAGGCCTGTATCTCCATGGCATACCTTACGTCATCGCGCCGGATGAG
CAGATCAAGGTGCCGATGATCTGGTGGCAGTCGAGTCAGGTTTATGCCGACCAAGCCTGTATGCAAACTCATGCCTCTCG
GGCACCGGTAAGTCACGATCACCTGTTTCACACCTTGCTCGGGATGTTCGACGTGAAAACCGCTGCCTACACGCCAGAGT
TGGACCTTCTGGCAACATGCAGAAAAGGACAACCACAATGA

>>MEG_3725|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGTATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCGCGCTCGCAATAGCGAGGGCCTGCTAGATGTGTTGCAAAAAACGGGGATCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAAATCGAACCAAAGGATCACCCTAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGTCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACACGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3726|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTGCCGCTCATATTTTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATTCTTTATAAATTAGAAGATTTTAAATTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAATTTTGCATTTGTTCCATTTTCGATACGGTATTTAGTAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGCGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCATTAGCATATTTAAGTTTGCCAATTATAGGATGGGTTACTATTGCTGGATTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTTAAAGGGATTCTAACTCGCGTCCTATCGATGTTTGCATCC
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTTTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAAATTGTTCCGGCCAATTTTGTTAATAGTACCGTTAAATATGTTTATAATCGTTATCTTGCAGAACCAATCCCATTTA
CTACTTTAGGTGATGATGCAAAACGGGATACTAATAAAAGTAAGCCCACGTTGATGTTCCTGGTCGTTGGTGAAACTGCT
CGTGGTAAAAATTTCTCGATGAATGGCTACGAGAAAGATACCAACCCATTTACCAGTAAATCTGGTGGTGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACAGCAACCGCTGTATCTGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCTCGCTCGTAATAGCGAGGGTTTGTTAGATGTGTTGCAGAAAACGGGGGTCTCCATTTTTTGGAAGGAGAAC
GATGGCGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAGGTCAAACCGAAGGATTACCCAAAGTTCTGCGATAA
AAATACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAACGCTACCCTGATGCTCATCGTCAGTTCACCCCTGATTGTCCA
CGCAGTGATATCGAAAACTGCACGGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGCAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCATTGCTCTACGTCTCCGATCACGGTGAAT
CACTGGGAGCTATGGGGCTTTACCTGCACGGTACACCGTACAAGTTTGCACCGGATGATCAGACCCGCGTACCTATGCAG
GTGTGGATGTCACCTGGATTTACCAAAGAGAAAGGCATGAATATGGAATGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA

>>MEG_3727|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGTTCAAGTATCTTTTATCTTTCAAACTGAACCCGGTACAACGGACCTGGGCTGCAGCATTTTTTTTCACTACAATCGG
CAACATAGCACTTTGGCAAACACTATGGATTAATGTAGATGTTCATAATATACATAATCTACTTTTTTTTGCCAGTCTGC
CAATATTTCTTTTCTGCTTTCTAAGTATCTTACTTACACCAGTCATGGTTATTCCATATTTATGCAGGCCTCTACTTGTA
GTTCTTATTCTAATCAGTGCCTGCTGTAGTTATTTCATGATGAAATACAACATATTAATTGACCGCAGCATGGTGCAAAA
CTTTTTTGAGACTAATCAGGCTGAATTAACATCATACTTATCCGTTCCTTTTCTTTCCACTCTATTTCTACTTGGCATTG
TACCAGCAATTATCCTGGCGTTGCCTTCAACAGACAATAAGCGGGGAGCTTTTAGAATTGAATTGTGGTGGTTGGCGCAT
ATTTGCATAGCTGTAGTCTTATTAGCCATGGTTACCATGGTGTTTTATAAGGATTACGCATCTCTCATACGAAACAATAT
GCAGATTAAAGACCAGGCTTTACCTTTTAACTTTGTGCGTAATACGAATGGTTACCTTAAAAGAAAATACCAGGCATCTT
CAACAATTCTACAAAGCGTGGGGGAGGATGCTGTACGTCCAATATATTCAAATGCTCCACCGAAACTGGTGGTTGTCGTC
GTGGGCGAAACCGCCAGAGCACAGAATTTCCAGCTGAATGGCTATTCGCGGGTAACCAACCCCTATCTTTCCAGACGACA
TGATGTTATCAGTTTCAAAAATGTGTCGTCATGCGGAACGGCTACCGCAATATCACTACCCTGCATGTTCTCGCGAATGT
CACGTAACGAATACAATGAAGTCCGTGCCGCATCAGAAGAAAACTTGCTGGATATCCTTAAACGTACAGGTGTTGAGGTG
CTATGGCGCAACAATAACAATGGTGGTTGTAAGGGAATCTGCAAGCGAGTACCCACAGATGATATGCCGGCAATGAAAGT
AATTGGGGAATGTGTTAACAAAGATGGTACATGCTTTGATGAGGTGTTATTAAATCAACTCTCATCCCGAATTAATGCAA
TGCAGGGTGATGCGCTTATTGTTTTACATCAAATGGGCAGTCATGGACCAACATATTTTGAACGTTATCCGTCTACAAGT
AAAGTCTTTAGCCCAACTTGCGACAGCAACCTGATCGAAAAATGCTCAAATAAAGAACTGGTCAATACATACGACAATAC
GCTAGTTTATACTGATCGTATGCTGAGCAAAACTATTGAACTGTTGCAACGTTATTCCGGGATGCGTGACGTTGCTATGA
TATATCTTTCTGATCATGGAGAATCGCTGGGGGAAAGCGGAATATATCTTCATGGCACACCATATATTATTGCCCCCAAT
GAACAAACACACATCCCGATGTTTATGTGGTTTTCGTCTTCATTCGCGCAGCATTCCAAATTAAATCTAGAATGCCTGAC
CGGTAATGCCGACAAACAATACAGTCATGATAATTTTTATCATTCAATACTTGGTCTCTTCAACGTAAAAACCAGTGTAT
ATAAACCGGAGTTAGATATGTTTACTCTATGTCGACAATCTGACCACACACCACTGTCTTCCGCAGTTGTAAGAGAGAAA
ACAGATGGGAATGGTTAG

>>MEG_3728|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
GTGATTTCTAGATTTAAGACGTTATCGGTTAACCAATTCACTTTCATCACTGCGTTGTTTTATGTTGCCATTTTCAATCT
ACCGCTCTTTGGTATAGTGCGAAAAGGAATTGAAAAACAACCAGAAGTTGATCCCCTTTTCATCGCATCTATGCCGCTAT
TTTTAACATTTGCGCTGAGTTTTTTGTTTTCAATTTTTACCGTCAAATACCTGCTGAAGCCCTTTTTTATCGTATTGACG
TTACTTTCCTCAAGTGTATTTTTTGCAGCCTATCAATACAATGTCGTGTTTGACTACGGCATGATAGAAAACACGTTTCA
AACACATCCTGCTGAAGCATTGATGTATGTAAATCTTGCATCAATTACCAATCTACTGCTGACTGGGCTATTACCGTCAT
ATCTTATTTATAAGGCCGATATTCATTATCAGCCCTTTTTTAAGGAGTTATTGCATAAATTAGCCTTTATGCTGCTAATG
TTCGTTGGCATTGGGATAGTCGCCTTTTTTTACTATCAAGATTATGCTGCATTTGTTCGAAACAACAGTGAGTTAAGGCG
TTACATTGTCCCTACCTATTTTGTCAGTAGTGCATCTAAATATCTCAATGAGCACTATTTGCAGACGCCCATGGAATACC
AACAACTTGGCCTAGATGCGAAGAATGCCAGTCGTAACCCGAACACTAAACCTAACTTATTAGTGGTTGTTGTGGGTGAA
ACTGCGCGCTCAATGAGCTATCAATATTATGGATATAACAAGCCAACCAATGCTCATACCCAAAATCAGGGGCTGATTGC
GTTTAACGATACTAGCTCATGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACGAATGGGGCGGGCAGACT
ATGATCCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGAT
AATGATTCTGGCTGTAAAGGTGTGTGTGATCGGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTC
TGGCCAATATTGTTTTGACCAAGTATTGCTCAACAAATTAGATAAAATTCTGGCAGTAGCACCAAGTCAAGATACAGTAA
TTTTTTTGCATATCATTGGTAGTCATGGACCAACTTATTATCTTAGATACCCGCCAGAGCATCGTAAATTTATACCGGAT
TGTCCGCGCAGTGATATTCAAAATTGCAGTCAAGAAGAACTGATTAACACCTACGACAACACTATTCTATATACGGATTT
TATTCTCAGTGAAGTGGTGAATAAATTAAAAGGTAAGCAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCATG
GTGAGTCTTTGGGTGAAAAGGGCATGTATTTACATGGTGCGCCCTATAGTATTGCACCGAAAGAACAAACTAGCGTACCA
ATGCTGGCTTGGGTATCTAATGACTTTAGCCAAGATAATCAGTTGAACATGACTTGTGTTGCACAGCGAGCAGAACAGGG
CGGCTTTTCCCACGACAATTTGTTCGACAGTTTGCTAGGACTTATGAATGTAAAAACCACCGTCTATCAGAGCCAACTCG
ATATTTTTGCACCTTGCAGGTATTAG

>>MEG_3729|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
GTGATTTCTAGATTTAAGACGTTATCGGTTAACCAATTCACTTTCATCACTGCGTTGTTTTATGTTGCCATTTTCAATCT
ACCGCTCTTTGGTATAGTGCGAAAAGGAATTGAAAAACAACCAGAAGTTGATCCCCTTTTCATCGCATCTATGCCGCTAT
TTTTAACATTTGCGCTGAGTTTTTTGTTTTCAATTTTTACCGTCAAATACCTGCTGAAGCCCTTTTTTATCGTATTGACG
TTACTTTCCTCAAGTGTATTTTTTGCAGCCTATCAATACAATGTCGTGTTTGACTACGGCATGATAGAAAACACGTTTCA
AACACATCTTGCTGAAGCATTGATGTATGTAAATCTTGCATCAATTACCAATCTACTGCTGACTGGGCTATTACCGTCAT
ATCTTATTTATAAGGCCGATATTCATTATCAGCCCTTTTTTAAGGAGTTATTGCATAAATTAGCCTTTATGCTGCTAATG
TTCGTTGGCATTGGGATAGTCGCCTTTTTTTACTATCAAGATTATGCTGCATTTGTTCGAAACAACAGTGAGTTAAGGCG
TTACATTGTCCCTACCTATTTTGTCAGTAGTGCATCTAAATATCTCAATGAGCACTATTTGCAGACGCCCATGGAATACC
AACAACTTGGCCTAGATGCGAAGAATGCCAGTCGTAACCCGAACACTAAACCTAACTTATTAGTGGTTGTTGTGGGTGAA
ACTGCGCGCTCAATGAGCTATCAATATTATGGATATAACAAGCCAACCAATGCTCATACCCAAAATCAGGGGCTGATTGC
GTTTAACGATACTAGCTCATGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACGAATGGGGCGGGCAGACT
ATGATCCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGAT
AATGATTCTGGCTGTAAAGGTGTGTGTGATCGGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTC
TGGCCAATATTGTTTTGACCAAGTATTGCTCAACAAATTAGATAAAATTCTGGCAGTAGCACCAAGTCAAGATACAGTAA
TTTTTTTGCATATCATTGGTAGTCATGGACCAACTTATTATCTTAGATACCCGCCAGAGCATCGTAAATTTATACCGGAT
TGTCCGCGCAGTGATATTCAAAATTGCAGTCAAGAAGAACTGATTAACACCTACGACAACACTATTCTATATACGGATTT
TATTCTCAGTGAAGTGGTGAATAAATTAAAAGGTAAGCAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCATG
GTGAGTCTTTGGGTGAAAAGGGCATGTATTTACATGGTGCGCCCTATAGTATTGCACCGAAAGAACAAACTAGCGTACCA
ATGCTGGCTTGGGTATCTAATGACTTTAGCCAAGATAATCAGTTGAACATGACTTGTGTTGCACAGCGAGCAGAACAGGG
CGGCTTTTCCCACGACAATTTGTTCGACAGTTTGCTAGGACTTATGAATGTAAAAACCACCGTCTATCAGAGCCAACTCG
ATATTTTTGCACCTTGCAGGTATTAG

>>MEG_3730|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
GTGATTTCTAGATTTAAGACGTTATCGGTTAACCAATTCACTTTCATCACTGCGTTGTTTTATGTTGCCATTTTCAATCT
ACCGCTCTTTGGTATAGTGCGAAAAGGAATTGAAAAACAACCAGAAGTTGATCCCCTTTTCATCGCATCTATGCCGCTAT
TTTTAACATTTGCGCTGAGTTTTTTGTTTTCAATTTTTACCGTCAAATACCTGCTGAAGCCCTTTTTTATCGTATTGACG
TTACTTTCCTCAAGTGTATTTTTTGCAGCCTATCAATACAATGTCGTGTTTGACTACGGCATGATAGAAAACACGTTTCA
AACACATCCTGCTGAAGCATTGATGTATGTAAATCTTGCATCAATTACCAATCTACTGCTGACTGGGCTATTACCGTCAT
ATCTTATTTATAAGGCCGATATTCATTATCAGCCCTTTTTTAAGGAGTTATTGCATAAATTAGCCTTTATGCTGCTAATG
TTCGTTGGCATTGGGATAGTCGCCTTTTTTTACTATCAAGATTATGCTGCATTTGTTCGAAACAACAGTGAGTTAAGGCG
TTACATTGTCCCTACCTATTTTGTCAGTAGTGCATCTAAATATCTCAATGAGAACTATTTGCAGACGCCCATGGAATACC
AACAACTTGGCCTAGATGCGAAGAATGCCAGTCGTAACCCGAACACTAAACCTAACTTATTAGTGGTTGTTGTGGGTGAA
ACTGCGCGCTCAATGAGCTATCAATATTATGGATATAACAAGCCAACCAATGCTCATACCCAAAATCAGGGGCTGATTGC
GTTTAACGATACTAGCTCATGCGGCACGGCCACGGCGGTGTCTCTACCCTGTATGTTTTCACGAATGGGGCGGGCAGACT
ATGATCCTCGCCGTGCTAATGCTCAAGACACAGTGATTGATGTGTTAAGTCATAGTGGTATAAAAGTACAGTGGTTTGAT
AATGATTCTGGCTGTAAAGGTGTGTGTGATCGGGTTGAAAATCTCACGATAGATTTGAAGAGTGATCCGAAGCTGTGTTC
TGGCCAATATTGTTTTGACCAAGTATTGCTCAACAAATTAGATAAAATTCTGGCAGTAGCACCAAGTCAAGATACAGTAA
TTTTTTTGCATATCATTGGTAGTCATGGACCAACTTATTATCTTAGATACCCGCCAGAGCATCGTAAATTTATACCGGAT
TGTCCGCGCAGTGATATTCAAAATTGCAGTCAAGAAGAACTGATTAACACCTACGACAACACTATTCTATATACGGATTT
TATTCTCAGTGAAGTGGTGAATAAATTAAAAGGTAAGCAGGATATGTTCGATACTGCAATGCTGTATCTCTCTGACCATG
GTGAGTCTTTGGGTGAAAAGGGCATGTATTTACATGGTGCGCCCTATAGTATTGCACCGAAAGAACAAACTAGCGTACCA
ATGCTGGCTTGGGTATCTAATGACTTTAGCCAAGATAATCAGTTGAACATGACTTGTGTTGCACAGCGAGCAGAACAGGG
CGGCTTTTCCCACGACAATTTGTTCGACAGTTTGCTAGGACTTATGAATGTAAAAACCACCGTCTATCAGAGCCAACTCG
ATATTTTTGCACCTTGCAGGTATTAG

>>MEG_3731|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTGTACTTTTCAGGGTGAAAGTTATTCCGCTGGTTTTACTTCTGGCAATGATCTTTGCGTTTTTACTTAACTGGCC
AATATTGCTGCATTTTTACGAGATTTTGTCGCATTTAGAGCATGTCAAAATTGGTTTTGTCATTTCTATTCCCTTTGTTC
TGGTTGCGGCGCTTAACGTTGTTTTTATGCCTTTCTCAGTTCGTTTTCTGCTGAAACCTTTCTTTGCTTTACTGTTTATC
ACTGGCTCACTGGTCAGTTATTCGACACTAAAATATAAAGTAATGTTTGATCAAACGATGATTCAAAACATTATTGAAAC
TAACCCCCAGGAAGCGCATTCCTATCTTAATGGCTCAATTATTATATGGTTCGTCTTTACCGGTATCCTTCCTGCCATCC
TCCTTTTTTCAATAAAAATTCAATATCCTGAAAAATGGTATAAAGGCATTGCTTACCGTTTGCTCTCCGTGCTGGCATCG
TTGAGTTTGATTGCAGGTGTTGCCGCACTTTATTATCAGGATTATGCCTCTGTCGGCCGCAATAACTCGACATTGAATAA
AGAGATCATCCCGGCGAACTACGCTTACAGCACTTTCCAGTATGTTAAGGATACGTACTTTACGACTAAAGTGCCTTTCC
AGACGCTGGGGAATGATGCTAAACGCGTCGTCGCTCACGAAAAACCCACGCTGATGTTCCTGGTGATTGGCGAAACGGCA
CGCAGCCAGAATTTCTCGATGAACGGTTATTCGCGTGATACCAATGCCTTTACCAGCAAATCCGGCGGCGTTATTTCGTT
TAAAAATATGCATTCCTGCGGTACCGCTACCGCAATATCCGTTCCGTGCATGTTCTCGAATATGAATCGCACCGAGTACG
ACAGTAAAAAAGCATCTAACAGTGAAAATTTCCTCGACATCGTGCAGAAAACCGGTGTCTCGCTGTTATGGAAAGAGAAC
GATGGCGGTTGTAAAGGCGTATGTAGCCGCATCCCGACTGTCGAAATTAAGCCTAGTGATAACCCGAAACTGTGCGATGG
CAAAACGTGCCATGACGAGGTGATGCTGGAAAACCTTGATGATGAAATCGCCAAAATGCCAGGTGATAAGCTTGTCGCCT
TCCATATCATTGGCAGCCATGGACCGACTTATTACCTGCGTTATCCGGCTGAGCATCGCCACTTCATGCCCGAATGTGCA
CGTAGCGATATCGAAAACTGTACTCAGGAACAATTGGTCAACACCTACGACAACACCCTTCGTTATACAGACTATGTATT
AGCTGAGATGATTGAAAAGCTAAAAAATTACAGCGATCAGTACAACACCGTGCTGCTTTATGTGTCCGATCATGGTGAAT
CATTGGGCGAAAGCGGGCTATATCTGCACGGCACGCCGTACAAACTGGCACCGGATCAGCAGACGCATATTCCGATGCAG
GTCTGGATGTCACCGGGCTTTATCGCCGGGAAACACATCAACATGTCTTGCCTTGAAAATAATGCGGCGAAAAAATCATA
TTCCCACGACAACCTGTTCTCATCGATTTTGGGGCTGTGGGACGTAAGCACCAGCGTCTATAATCCTGACCGCGATTTGT
TCCGCGAATGCCGTGGCTAA

>>MEG_3732|Drugs|Lipopeptides|Colistin_phosphoethanolamine_transferase|MCR
ATGCCTTCCCTTATAAAAATAAAAATTGTTCCGCTTATGTTCTTTTTGGCACTGTATTTTGCATTTATGCTGAACTGGCG
TGGAGTTCTCCATTTTTACGAAATCCTTTACAAATTAGAAGATTTTAAGTTTGGTTTCGCCATTTCATTACCAATATTGC
TTGTTGCAGCGCTTAACTTTGTATTTGTTCCATTTTCGATACGGTATTTAATAAAGCCTTTTTTTGCACTTCTTATCGCA
CTTAGTGCAATCGTTAGTTACACAATGATGAAGTATAGAGTCTTGTTTGATCAAAACATGATTCAGAATATTTTTGAAAC
CAATCAAAATGAGGCGTTAGCATATTTAAGCTTACCAATTATAGTATGGGTTACTATTGCTGGTTTTATCCCTGCCATTT
TACTTTTCTTTGTTGAAATTGAATATGAGGAAAAATGGTTCAAAGGGATTCTAACTCGTGCCCTATCGATGTTTGCATCA
CTTATAGTGATTGCGGTTATTGCAGCACTATACTATCAAGATTATGTGTCAGTGGGGCGCAACAATTCAAACCTCCAGCG
TGAGATTGTTCCAGCCAATTTCGTTAATAGTACCGTTAAATACGTTTACAATCGTTATCTTGCTGAACCAATCCCATTTA
CAACTTTAGGTGATGATGCAAAACGGGATACTAATCAAAGTAAGCCCACGTTGATGTTTCTGGTCGTTGGTGAAACCGCT
CGTGGTAAAAATTTCTCGATGAATGGCTATGAGAAAGACACCAATCCATTTACCAGTAAATCTGGTGGCGTGATCTCCTT
TAATGATGTTCGTTCGTGTGGGACTGCAACCGCTGTATCCGTCCCCTGCATGTTCTCCAATATGGGGAGAAAGGAGTTTG
ATGATAATCGCGCTCGCAATAGCGAGGGCCTGCTAGATGTGTTGCAAAAAACGGGGATCTCCATTTTTTGGAAGGAGAAC
GATGGAGGCTGCAAAGGCGTCTGCGACCGAGTACCTAACATCGAAATCGAACCAAAGGATCACCCTAAGTTCTGCGATAA
AAACACATGCTATGACGAGGTTGTCCTTCAAGACCTCGATAGTGAAATTGCTCAAATGAAAGGGGATAAGCTGGTTGGCT
TCCACCTGATAGGTAGCCATGGCCCAACCTACTACAAGCGCTACCCTGATGCTCATCGTCAGTTCACCCCTGACTGTCCA
CGCAGTGATATTGAAAACTGCACAGATGAAGAGCTCACCAACACCTATGACAACACCATCCGCTACACCGATTTCGTGAT
TGGAGAGATGATTGCCAAGTTGAAAACCTACGAAGATAAGTACAACACCGCGTTGCTCTACGTCTCCGATCATGGTGAAT
CACTGGGAGCATTAGGGCTTTACCTACACGGTACACCGTACCAGTTTGCACCGGATGATCAGACCCGTGTTCCTATGCAG
GTGTGGATGTCACCTGGATTTATCAAAGAGAAAGGCGTTGATATGGCGTGTTTGCAGCAGAAAGCCGCTGATACTCGTTA
CTCACACGATAATATTTTCTCATCTGTATTGGGTATCTGGGACGTCAAAACATCAGTTTACGAAAAGGGTCTAGATATTT
TCAGTCAATGTCGTAATGTTCAATAA