MEGAResFrom MEG, the Microbial Ecology Group

GOLS

The golS gene encodes a MerR family regulator of the mdsABC efflux system. This system is known for resistance to gold.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Sequences

Download Sequences

>>MEG_3167|Metals|Gold_resistance|Gold_resistance_regulator|GOLS
ATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTACTATGAACAGATTGGTCTGATTCC
CGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTATACGCCGCGCGC
GCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTC
AAACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGC
GCTGATTCACTGCTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGACAACCTGACGATAGCGAGC
CGGAGGCGCGTACCGGAGCGGTATTGCGACGTCCTCGTCGCCACGGACTGGCAAAGCGTCTGTAA