MEGAResFrom MEG, the Microbial Ecology Group

RPOC

The rpoC gene encodes a subunit of the 30S rRNA polymerase. Mutations in this protein have been linked with resistance to daptomycin.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/16723576

Other Groups in Vancomycin-resistant mutation

Sequences

Download Sequences

>>MEG_6138|Drugs|Glycopeptides|Vancomycin-resistant_mutation|RPOC|RequiresSNPConfirmation
TTGTTTGAATTAAACAATTTCGAGTCGATAAAAATAGCATTGGCTTCTCCAGAAAAAATAAGACAATGGTCTAGGGGAGA
AGTTAAAAAGCCAGAAACTATAAATTACCGTACTTTAAAACCAGAAAAAGATGGTCTTTTCTGTGAAAGAATATTTGGAC
CACAAAAAGACTGGGAGTGCCACTGTGGTAAATATAGAAGAGTTAGATATAAAGGTGTAGTTTGTGATAGATGTGGAGTA
GAAGTAACTAAATCAAAAGTAAGAAGAGAGAGAATGGGACATATAGAGCTAGCTGCTCCTATGTCTCACATCTGGTACTT
CAAAGGTATACCAAGTAGAATGGGACTTTTACTTGATATGTCACCAAGATCGTTAGAAAAAATATTATACTTTGCCTCAT
ATGTGGTAGTTGATCCAGGAGAGACTGGATTAAACGAAAAACAATTGCTTACAGAAAAAGAATACAGAACTGCTCTTGAA
AAGTATGGATATACTTTTACTGTAGGAATGGGTGCTGAAGCTGTAAAGACATTACTACAAAATATAGATTTAGAGCAACA
AAGTAAAGACCTAAGAGCGGAGTTAAAAGATAGTACAGGGCAAAAGAAAGTTAGAACAATAAGAAGATTAGAAGTTGTAG
AGGCATTTAAAAAGTCTGGAAATAAACCAGAATGGATGATTTTAGATGCAATACCAGTAATACCACCAGATTTAAGACCA
ATGGTACAACTTGATGGTGGAAGATTTGCGACTTCAGACCTAAATGATTTATATAGAAGAGTTATAAATAGAAACAATAG
ACTTAAAAGATTATTAGAGCTTGGAGCTCCAGATATAATTGTAAGAAATGAAAAAAGAATGCTTCAAGAAGCTGTTGATG
CATTGATAGATAATGGTAGAAGAGGTAGACCTGTAACAGGACCTGGAAATAGACCACTTAAATCTTTATCAGATATGTTA
AAAGGTAAGCAAGGTCGTTTCCGTCAAAACTTACTTGGTAAGCGTGTTGACTACTCAGGACGTTCTGTTATAGTTGTTGG
ACCAGAACTTAAATTTTATCAATGTGGACTTCCAAAGAAGATGGCATTAGAATTATTCAAGCCATTTGTTATGGATAAAT
TAGTTAAAGAAGGTTATGCACATAATATAAAAAGTGCGAAATCTATAGTAGAAAAAGTTAAGCCAGAAGTTTGGGATGTT
TTAGAAGATGTTATAAAAAGTCATCCAGTTCTTCTTAACCGTGCACCGACTCTACATAGATTAGGTATACAAGCATTTGA
ACCAATCTTAGTTGAAGGTAAGGCTATAAAACTACATCCTCTTGTATGTACAGCTTATAATGCAGACTTTGATGGTGACC
AAATGGCAGTCCATGTACCTTTATCAGTAGAAGCACAAGCAGAAGCAAGATTCTTAATGCTTTCTGTAAATAATATACTT
GCTCCTAAAGATGGTTCACCTATAACTACTCCATCTCAGGATATGGTTTTAGGTTGCTATTATCTAACAATAGAAGCCCA
AGATGGAGCTAAAGGAACAGGTATGGTATTTAAAGACTTTAATGAACTATTACTTGCTTATTACAATAAATCAGTTCATC
TACATGCATTAGTGAAACTGAAGGTAACACTTGAAGATGGAAGAAGTTCATTGGTTGAAAGTACTGTTGGTAGATTTATA
TTTAATGAAAATATACCTCAAGACTTAGGTTTTGTAGATAGAAAAGAAAATCCATTTGCACTTGAAGTTGATTTCTTAGC
AGATAAAAAATCTCTTGGTAAAATAATAGATAAATGCTTTAGAAAACACGGAAATACAGAAACAGCTGAATTACTAGATT
ATATAAAAGCTCTAGGATTTAAATATTCTACATTAGGTGGTATAACAGTTGCTGTTGATGATATGAGTGTCCCAGAAGAA
AAGAAAGTATTTATAGCTGAGGCAGAAGCTAAAGTTGATAAGTATGAAAAAGCATACAGAAGAGGTCTAATCTCTGATGA
AGAAAGATATGAAAAAGTTATAGAGACATGGACAGAAACAACTGATAAAGTTACTGATGCTCTTATGGGTGGACTAGATA
GATTAAATAATATATATATAATGGCACATTCAGGAGCCAGAGGTTCTAAAAACCAAATTAGACAGCTGGCAGGTATGCGT
GGTCTTATGGCAAATGCATCTGGTAAAACAGTTGAGATACCAGTTAAATCTAATTTCCGTGAAGGTTTATCAGTACTAGA
ATACTTTACATCTTCACATGGAGCCAGAAAAGGTCTTGCCGATACAGCTATACGTACAGCTGAATCTGGATATTTAACAA
GAAGACTTGTTGATGTAAGTCAAGATGTTATTGTAAGGGAAATAGATTGTGGAACAGAAGATACTACAGAGATTTATGCT
ATAAAAGAAGGAAATGAAGTTATAGAAGAGATATATGATAGAATTGTAGGAAGATATACTATAGACCCTATATTAAATCC
TGAAACTGGAGAAGTTATAGTTGAGGCTGATTCAATGATACAAGAAGATGAAGCAGAAACTATAGTAGCTTTAGGAATTG
AAAAAATTAGGATAAGAACAGTTCTTAACTGTAAAACTAATCATGGAGTTTGTTCTAAGTGTTATGGTAGAAACTTGGCA
ACAGGAAAAGAAGTTAATATAGGTGAAGCAGTTGGTATAATAGCAGCTCAATCTATCGGTGAGCCGGGTACTCAGCTTAC
AATGCGTACATTCCATACTGGAGGAGTTGCAGGAGCTGATATAACTCAAGGTCTACCAAGGGTTGAAGAATTATTTGAAG
CTAGAAAACCAAAAGGATTAGCTGTAATAACTGAAGTATCTGGTAGAGTTGAAATTGATGAAACAGGAAAGAGAAAAGAA
GTAAATGTAATACCAGAAGAAGGCGAGACTCAAACATATGTAATTCCATATGGTTCTAGATTAAAAGTTAAGCAAGGTCA
AATGCTAGAGGCTGGAGACCCTCTAACACAAGGATTTATAAATCCTCATGATATAGTAAGAGTAAATGGTGTTAAGGGAG
TTCAAGAATATATAGTTAAAGAAGTTCAAAGAGTGTATAGACTTCAAGGGGTTGACGTTAATGATAAGCATATAGAAGTT
ATAGTAAGACAAATGCTATCTAAAGTAAAAGTTGAAGACCCAGGAGATACAGATTTATTGCCAGGTGGATATGAAGATGT
ATTAACATTCAATGAATGTAATAAAGATGCTATAGATAAAGGTCTAAGACCAGCAGTTGCTAAAAGAGTTTTACTTGGTA
TAACTAAAGCATCTCTTGCAACTGATTCATTCTTATCAGCAGCTTCTTTCCAAGAAACAACAAGAGTATTAACAGAGGCA
GCAATAAAAGGTAAAGAAGACCACTTAATAGGACTTAAAGAAAATGTTATATTAGGTAAGTTAATACCAGCAGGAACAGG
AATGAAGAAATATAGAAATATAGCTGTTGAAAAAATTGAAGATTAA