MEGAResFrom MEG, the Microbial Ecology Group

MURG

The MURG group of genes confer resistance to Glycopeptides through the mechanism, Vancomycin-resistant mutation.

References

    Other Groups in Vancomycin-resistant mutation

    Sequences

    Download Sequences

    >>MEG_4097|Drugs|Glycopeptides|Vancomycin-resistant_mutation|MURG|RequiresSNPConfirmation
    ATGAAAAAACTGAAAATAGTAATGACGGGTGGAGGTTCTGCTGGACATGTTACCCCTAATTTAGCACTTGTGCCAAAACT
    AAAGGAGCTAGGATACGAAATAGAGTATATAGGAACAAAGGATGGGATAGAAAGAAGTATAATTGAAAAAGAAAATATAA
    AGTATAATTGTATATCCAGTGGAAAATTAAGAAGATATATTGATATTAAAAATTTTTCAGATCCTTTTAAGGTTATTTTA
    GGGATATTTCAATCTGTTAGTATATTAAGGAAGAAAAAGCCTAACATAGTCTTTTCTAAAGGAGGTTTTGTGTCAGTTCC
    TGTGGTTATAGCAGCACATTTTTGCAGAATACCGGTAATAGCTCATGAATCAGATATAACACCTGGACTTGCAAATAGGA
    TAGCAGTTCCTTACTGCACAAAAGTTTGTGCTACATTTCCAGAATCTCTTAACAATATAAAAGGGAATAAGGGAATATTA
    ACAGGTACTCCTATACGAGATGAGTTATTTAAGGGAAGTAAAATTAAGGGACTTGAAATATGTGGATTTACAGGTGAGAA
    GCCAGTACTTATGATTATAGGTGGAAGTTTAGGATCAAAGATTATAAATGATACAGTTCGTGAAGCTTTAAATAAGCTTA
    TAAAAAAATATGATATAGTTCATATTTGTGGAAAGGGAAATATAGATGAAGCTTTAAGTAAACTTAAGGGGTATAAGCAA
    TTTGACTATATATCAACTGAACTTCCTCATGTAATGAATGCTGCAGATTTAGTTATTTCAAGAGCAGGGGCTAATGCTAT
    TTTTGAGCTTTTAGCATTAAAAAAGCCTAATTTATTGATCCCATTATCTAAAAAATCAAGCAGGGGAGATCAGATTTTAA
    ATGCTATGTCATTTGAAAAAAATGGTTACAGTATGGTGGTTCAGGAAGATGACTTAACACCAACGTTGCTTGTAGAGAAG
    GTCATTAAACTTGAAAGCGATAAGGAAAAATACAAGAAAGCTATGAATTCAAGTCCTGTAAAAAATGGTGTGGAAAATAT
    AATTAAAGTTATTGATAAATATAAAAAATGTAAAATATAG