MEGAResFrom MEG, the Microbial Ecology Group

VANXO

The vanX gene encodes a dipeptidase. This gene is part of the VanO operon and is a core resistance gene.

References

Sequences

Download Sequences

>350|KF478993.1|KF478993|Glycopeptides|VanO-type_resistance_protein|VANXO
ATGAACGACGACTTCGTCTACGTCGACGACTGGGTGCCCGGAGTCCGCTGGGATGCCAAGTACGCCACGTGGGACAACTT
CACCGGCAAACCGGTAGACGGCTACCTCGCGAATCGAATCGTCGGCACCCGGGCTTTGTGCGCGGCCCTCGAGCAAGCAC
GCGAGAAGGCAGCTTCCCTCGGCTTCGGATTGCTTCTCTGGGACGGCTACCGTCCTCGACGCGCCGTCGACAGCTTCCTA
CGCTGGTCAGAACAGCCGGAGGATGGCCAGACGAAGCAGCGACACTATCCCAATATCGACAGACCCGAGATGCTCGAAAA
GGGATACGTGGCAACCCAGTCGGGCCACAGTAGGGGCGGCGCCGTTGACCTGACGCTCTATCACCTTGCGACCGGTGAAC
TTGCTCCTATGGGTGGCGACCACGACCTCATGGACCCGATCTCACATCATCGAGCGCGAGGAATCAAGCCAATCGAGTCC
AAGAATCGTGAGCTTCTTCGTTCCATCATGGAGGACTGCGGATTTGATCGGTACGACTGCGAGTGGTGGCACTACACGCT
GAAACGCGAACCATATCCAGATGTCTACTTCGACTTTCCGATCACGTGA