MEGAResFrom MEG, the Microbial Ecology Group

VANSO

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanO operon and is a regulator gene.

References

Other Groups in VanO-type regulator

Sequences

Download Sequences

>CARD|phgb|KF478993|4909-5947|ARO:3002941|vanSO|Glycopeptides|VanO-type_regulator|VANSO
TTACGGTCGTCGCTGAGCGGCGGGCAGTCGCACTGCTACGGAGAGCCCGCCGGCAGCTCGGGGGCTGAGCGTGAGGGATC
CGTCGTGTGCCTGCGTGATGCTCTTGACGATCGCCAGGCCAAGGCCCACCCTCGCATCGTCCCCGCGGGTGCGAGCAGTG
CCGCGCTGAAACGGCTCGGTGAGTGTCGAGACCAACTGTGGACTGAGCTTGTCGCCGGTGTTCTCGACCGTGAGCATGAC
GGACTCGGAGCCGATGGCGGTGCTGATCTGCACGCTGCCGTGCTCGGGGACATTGTGGACGATCGCATTGTGCAGAAGGT
TCGTAGTCAACTGCAGCAAGAGTGCGTGTGAGCCGATGACCGGCGCGATGTCCCCGGAGGTCTCGATGCTGACGCCGTGC
TTCTCCGCGAACGGGAGGAGTGTCTCGGCGGCTTCTTCCGCGATGAGCGACAGATCGACGTCTTCTCGGCTGAAGGACCG
TTGGTCGGTACGGCTGAGCAGGAGCAATGCCTCGGTGAGCTCGATCGCCCGTGCGTTGACAGCGCGGAGGCGTTCGTCGA
GCTCGCCGCCGTCGCGGTTCGGATCGTTGCGGGCGACATCGAGAAGGGTTTGTGTGATCGCCAGCGGGGTGCGCAACTCG
TGGGAGGCGTTGGCGGCGAATCGCTGCTGCGCGGCGTCTCGTGCTTCGAGCCGTGCGAGCATGGCGTCGAAGGCATCGGC
AAGTTCACGGAACTCGTCGTTGCGTCCCTCCAGTTCGATCCGGTACGACAGCGAGCCACTCCCCGCCTCCCGCGCGGCGC
GCGTAATGCGCGCCAACGGGGCAAGCATTCGGCCCGCGAGAATCCAACCACCCACAAGGCCGAACACCAGCAAGAACCCG
AGCGCCAAGATCGCTGCCGGGACAAACACCACGGGACCGAAGTTGCTCGGGTCGAAGACCCGGGCAAAGTCGGCCAGAGC
AGGGAATTGGAAATTCGTGGACCGCCCTCTCAGCAGGAAAACCCAAACCGCCGCAAGGAGCAAGACACCAGCGAGCATG

>353|unknown_id|unknown_name|Glycopeptides|VanO-type_regulator|VANSO
ATGCTCGCTGGTGTCTTGCTCCTTGCGGCGGTTTGGGTTTTCCTGCTGAGAGGGCGGTCCACGAATTTCCAATTCCCTGC
TCTGGCCGACTTTGCCCGGGTCTTCGACCCGAGCAACTTCGGTCCCGTGGTGTTTGTCCCGGCAGCGATCTTGGCGCTCG
GGTTCTTGCTGGTGTTCGGCCTTGTGGGTGGTTGGATTCTCGCGGGCCGAATGCTTGCCCCGTTGGCGCGCATTACGCGC
GCCGCGCGGGAGGCGGGGAGTGGCTCGCTGTCGTACCGGATCGAACTGGAGGGACGCAACGACGAGTTCCGTGAACTTGC
CGATGCCTTCGACGCCATGCTCGCACGGCTCGAAGCACGAGACGCCGCGCAGCAGCGATTCGCCGCCAACGCCTCCCACG
AGTTGCGCACCCCGCTGGCGATCACACAAACCCTTCTCGATGTCGCCCGCAACGATCCGAACCGCGACGGCGGCGAGCTC
GACGAACGCCTCCGCGCTGTCAACGCACGGGCGATCGAGCTCACCGAGGCATTGCTCCTGCTCAGCCGTACCGACCAACG
GTCCTTCAGCCGAGAAGACGTCGATCTGTCGCTCATCGCGGAAGAAGCCGCCGAGACACTCCTCCCGTTCGCGGAGAAGC
ACGGCGTCAGCATCGAGACCTCCGGGGACATCGCGCCGGTCATCGGCTCACACGCACTCTTGCTGCAGTTGACTACGAAC
CTTCTGCACAATGCGATCGTCCACAATGTCCCCGAGCACGGCAGCGTGCAGATCAGCACCGCCATCGGCTCCGAGTCCGT
CATGCTCACGGTCGAGAACACCGGCGACAAGCTCAGTCCACAGTTGGTCTCGACACTCACCGAGCCGTTTCAGCGCGGCA
CTGCTCGCACCCGCGGGGACGATGCGAGGGTGGGCCTTGGCCTGGCGATCGTCAAGAGCATCACGCAGGCACACGACGGA
TCCCTCACGCTCAGCCCCCGAGCTGCCGGCGGGCTCTCCGTAGCAGTGCGACTGCCCGCCGCTCAGCGACGACCGTAA