MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

VANSO

The vanS gene encodes a sensory His-kinase and is part of the two-component sensor-kinase system. This gene is part of the VanO operon and is a regulator gene.

References

  • http://cid.oxfordjournals.org/content/42/Supplement_1/S25.full,http://www.readcube.com/articles/10.1038/ja.2013.117

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in VanO-type regulator

Sequences

Download Sequences

>>MEG_7522|Drugs|Glycopeptides|VanO-type_regulator|VANSO
gtggatagagcgcctgggttgggcgttcgcctcaaactcactctcagttatgccgggttcctcatgctcgctggtgtctt
gctccttgcggcggtttgggttttcctgctgagagggcggtccacgaatttccaattccctgctctggccgactttgccc
gggtcttcgacccgagcaacttcggtcccgtggtgtttgtcccggcagcgatcttggcgctcgggttcttgctggtgttc
ggccttgtgggtggttggattctcgcgggccgaatgcttgccccgttggcgcgcattacgcgcgccgcgcgggaggcggg
gagtggctcgctgtcgtaccggatcgaactggagggacgcaacgacgagttccgtgaacttgccgatgccttcgacgcca
tgctcgcacggctcgaagcacgagacgccgcgcagcagcgattcgccgccaacgcctcccacgagttgcgcaccccgctg
gcgatcacacaaacccttctcgatgtcgcccgcaacgatccgaaccgcgacggcggcgagctcgacgaacgcctccgcgc
tgtcaacgcacgggcgatcgagctcaccgaggcattgctcctgctcagccgtaccgaccaacggtccttcagccgagaag
acgtcgatctgtcgctcatcgcggaagaagccgccgagacactcctcccgttcgcggagaagcacggcgtcagcatcgag
acctccggggacatcgcgccggtcatcggctcacacgcactcttgctgcagttgactacgaaccttctgcacaatgcgat
cgtccacaatgtccccgagcacggcagcgtgcagatcagcaccgccatcggctccgagtccgtcatgctcacggtcgaga
acaccggcgacaagctcagtccacagttggtctcgacactcaccgagccgtttcagcgcggcactgctcgcacccgcggg
gacgatgcgagggtgggccttggcctggcgatcgtcaagagcatcacgcaggcacacgacggatccctcacgctcagccc
ccgagctgccggcgggctctccgtagcagtgcgactgcccgccgctcagcgacgaccgtaa

>>MEG_7523|Drugs|Glycopeptides|VanO-type_regulator|VANSO
ATGCTCGCTGGTGTCTTGCTCCTTGCGGCGGTTTGGGTTTTCCTGCTGAGAGGGCGGTCCACGAATTTCCAATTCCCTGC
TCTGGCCGACTTTGCCCGGGTCTTCGACCCGAGCAACTTCGGTCCCGTGGTGTTTGTCCCGGCAGCGATCTTGGCGCTCG
GGTTCTTGCTGGTGTTCGGCCTTGTGGGTGGTTGGATTCTCGCGGGCCGAATGCTTGCCCCGTTGGCGCGCATTACGCGC
GCCGCGCGGGAGGCGGGGAGTGGCTCGCTGTCGTACCGGATCGAACTGGAGGGACGCAACGACGAGTTCCGTGAACTTGC
CGATGCCTTCGACGCCATGCTCGCACGGCTCGAAGCACGAGACGCCGCGCAGCAGCGATTCGCCGCCAACGCCTCCCACG
AGTTGCGCACCCCGCTGGCGATCACACAAACCCTTCTCGATGTCGCCCGCAACGATCCGAACCGCGACGGCGGCGAGCTC
GACGAACGCCTCCGCGCTGTCAACGCACGGGCGATCGAGCTCACCGAGGCATTGCTCCTGCTCAGCCGTACCGACCAACG
GTCCTTCAGCCGAGAAGACGTCGATCTGTCGCTCATCGCGGAAGAAGCCGCCGAGACACTCCTCCCGTTCGCGGAGAAGC
ACGGCGTCAGCATCGAGACCTCCGGGGACATCGCGCCGGTCATCGGCTCACACGCACTCTTGCTGCAGTTGACTACGAAC
CTTCTGCACAATGCGATCGTCCACAATGTCCCCGAGCACGGCAGCGTGCAGATCAGCACCGCCATCGGCTCCGAGTCCGT
CATGCTCACGGTCGAGAACACCGGCGACAAGCTCAGTCCACAGTTGGTCTCGACACTCACCGAGCCGTTTCAGCGCGGCA
CTGCTCGCACCCGCGGGGACGATGCGAGGGTGGGCCTTGGCCTGGCGATCGTCAAGAGCATCACGCAGGCACACGACGGA
TCCCTCACGCTCAGCCCCCGAGCTGCCGGCGGGCTCTCCGTAGCAGTGCGACTGCCCGCCGCTCAGCGACGACCGTAA