MEGAResFrom MEG, the Microbial Ecology Group

VANRO

The vanR gene encodes a response regulator that is part of the two-component sensor-kinase system. This gene is part of the VanO operon and is a regulator gene.

References

Other Groups in VanO-type regulator

Sequences

Download Sequences

>CARD|phgb|KF478993|6002-6704|ARO:3002930|vanRO|Glycopeptides|VanO-type_regulator|VANRO
CTATCCACCGTCGCCCCCGCCTCTGGCGTCCGGTTCGGTATCGATGCGGTACCCGACCCCCGGCACCGTGGCGATCAGCC
ACGGTTCGCCGAGCCGCTTGCGCAACGTCGAGACCGTGATGCGCACGGCATTCGTGAACGGATCGGCGTTCTCGTCCCAC
GCCCGCTCCAGCAACTCCTCGGCGCTGATCACACCGCCCTCGGCAGCGACGAGAACTTCGAGCACCGCGAACTGCTTCCG
GGTCAGCGCGACGTACCGGCCGTCCCGGTAGACCTCGCGACGGAACGGGTCCAGCTGCAGACCAGCGATCTCCCGCACGG
GCGGCCTGCTGTGCGCGCGCCTGCGGTCGAGGGCCCGGAGACGGAGCACGAGCTCCTGCAGCTCGAAAGGCTTGGTGAGG
TAGTCGTCGGCACCGAGCTCGAACCCGGAGGCCTTGTCGTCCATCCGGTCCGCGGCAGTGAGCATCAGGATTGGTATGCC
GCCACCGGAAGCGACGATGCGCTGGGCGATCTCGTCACCGGAGGGGCCGGGGATATCACGGTCGAGGACGGCGATGTCGT
AGGCGTTGACGCCCAACAGATCCAGGGCAGTGTCCCCATCACCGGCGATGTCGGCCGCGATCGCTTCCAGGCGCAGCCCA
TCGCGGATGGCTTCCGCCATGAACCGCTCGTCCTCGACGACCAACACACGCATGCTCGCCATG

>354|unknown_id|unknown_name|Glycopeptides|VanO-type_regulator|VANRO
ATGGCGAGCATGCGTGTGTTGGTCGTCGAGGACGAGCGGTTCATGGCGGAAGCCATCCGCGATGGGCTGCGCCTGGAAGC
GATCGCGGCCGACATCGCCGGTGATGGGGACACTGCCCTGGATCTGTTGGGCGTCAACGCCTACGACATCGCCGTCCTCG
ACCGTGATATCCCCGGCCCCTCCGGTGACGAGATCGCCCAGCGCATCGTCGCTTCCGGTGGCGGCATACCAATCCTGATG
CTCACTGCCGCGGACCGGATGGACGACAAGGCCTCCGGGTTCGAGCTCGGTGCCGACGACTACCTCACCAAGCCTTTCGA
GCTGCAGGAGCTCGTGCTCCGTCTCCGGGCCCTCGACCGCAGGCGCGCGCACAGCAGGCCGCCCGTGCGGGAGATCGCTG
GTCTGCAGCTGGACCCGTTCCGTCGCGAGGTCTACCGGGACGGCCGGTACGTCGCGCTGACCCGGAAGCAGTTCGCGGTG
CTCGAAGTTCTCGTCGCTGCCGAGGGCGGTGTGATCAGCGCCGAGGAGTTGCTGGAGCGGGCGTGGGACGAGAACGCCGA
TCCGTTCACGAATGCCGTGCGCATCACGGTCTCGACGTTGCGCAAGCGGCTCGGCGAACCGTGGCTGATCGCCACGGTGC
CGGGGGTCGGGTACCGCATCGATACCGAACCGGACGCCAGAGGCGGGGGCGACGGTGGATAG